1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergeeva-Olga [200]
3 years ago
8

Explain what an individual would have to have genetically to show the recessive trait

Biology
1 answer:
LiRa [457]3 years ago
6 0

hi there

the answer to this is

Only individuals with an aa phenotype will the express a recessive trait; therefore,the offspring must have receive one recessive allele from each parents to exhibit a recessive trait. One example of a recessive inherited trait is a smooth chin, the  Domnait allele is the  cliff chin

i hope this helped u out

have a great evening

FaithRawlins14

You might be interested in
Sperm cells are found inside pollen. What kind of cells are sperm?
Blababa [14]
Do you still need help?!?
6 0
3 years ago
Cho trâu đực đen 1 giao phối với trâu cái đen 2. Năm đầu sinh được nghé đen 3 và năm sau sinh được nghé xám 4.
Anestetic [448]
Please translate to English

Hope you’re having a positive day
6 0
2 years ago
Fossil evidence indicates that Myllokunmingia, the earliest known vertebrate, had feathery gills, skeletal structures thought to
BlackZzzverrR [31]
Unit 3 Lesson 6: chordate evolution and diversity quick check answers.  

1. B
2. D
3. B
4. B
5. B
5 0
2 years ago
Read 2 more answers
Which epithelial layers arise(s) from the endoderm?
Morgarella [4.7K]
The embryonic endoderm<span> develops into the interior linings of two tubes in the body, the digestive and respiratory tube. the </span>lining<span> of the follicles of the thyroid gland and the</span>epithelial<span> component of the thymus (i.e. thymic </span>epithelial<span> cells). Liver and pancreas cells are believed to </span>derive<span> from a common precursor.</span>
7 0
2 years ago
Which part of the brain is responsible for coordinating muscle movements and maintaining balance?
mr Goodwill [35]
The Cerebellum is responsible for coordinating muscle movements and maintaining balance
7 0
3 years ago
Other questions:
  • A 20-year-old male is hospitalized with a 4-day history of cough and a temperature of 41°c. chest sounds are dull to percussion.
    8·1 answer
  • 19
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How do bone markings on modern human skeletons relate to bone markings found on the fossils of common ancestors?
    9·1 answer
  • Choose a plant or animal that you think is interesting. describe some of the threats or challenges
    6·1 answer
  • Which was one of the first animals to develop a true body cavity?
    5·2 answers
  • One important development during the 3rd trimester that will insulate the infant against changes in temperature is _____________
    6·1 answer
  • why the concentration of nitrate ion in the soil had decreased after the farmer grew maize plants in the field?​
    8·2 answers
  • Tour<br>1 - Quelll definition generale correspond le mieux à une roche​
    7·1 answer
  • In a population of birds, the color of their feathers is controlled by an incompletely dominant gene. Homozygotes of one type ar
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!