1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
a_sh-v [17]
3 years ago
8

This macromolecule is composed of carbon, hydrogen and oxygen but is not a lipid

Biology
1 answer:
ratelena [41]3 years ago
5 0

Answer:

If the macromolecule is not lipid, then IT'S CARBOHYDRATE

You might be interested in
Which of the following statements is part of the cell theory?
Sophie [7]
Answer would be D)<span>all of these</span>
6 0
3 years ago
Read 2 more answers
Describe two examples of chemical weathering.
lapo4ka [179]

Answer:

Types of Chemical Weathering

Carbonation. When you think of carbonation, think carbon! ...

Oxidation. Oxygen causes oxidation. ...

Hydration. This isn't the hydration used in your body, but it's similar. ...

Hydrolysis. Water can add to a material to make a new material, or it can dissolve a material to change it. ...

Acidification.

7 0
3 years ago
The enzyme carbonic anhydrase is a protein that binds to two small molecules: water and carbon dioxide. By holding the two molec
ipn [44]

Answer:i know its not b for sure i checked

Explanation:

7 0
2 years ago
What is the name for the H* ion?
Lady bird [3.3K]

Answer:

Hydrogen ion  

Explanation:

The name of H⁺ is hydrogen ion.

The name of H₃O⁺ is hydronium ion.

8 0
2 years ago
Do I have these correct
guajiro [1.7K]
Yes, you do because you did.
5 0
3 years ago
Other questions:
  • Watson and Crick discovered that DNA is __________. A. the genetic information B. very small C. a double helix D. a treatment fo
    9·2 answers
  • Sexual reproduction involves the combining of genetic material or DNA. true or false?
    15·1 answer
  • Which of these will increase the charge in a neuron relative to its surroundings?
    14·2 answers
  • If a tRNA anticodon is CAA, what is its corresponding mRNA codon? In the genetic code, which amino acid does this codon codify
    6·1 answer
  • Hair has a medulla region that is variable. Describe the possible variations
    15·1 answer
  • Why would diabetes make a person feel tired? Be specific in your response.
    7·2 answers
  • The species of tree shown below grows in a wide range of temperatures in a desert area in Africa, where average temperatures hav
    5·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • How would you differentiate between pollen cells and algae cells
    7·1 answer
  • a student is investigating cellular transport. what will most likely occur when the student places a cell that is 95% water insi
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!