1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nata0808 [166]
3 years ago
15

How does consciously thinking about the behavior affect your performance of it?

Biology
1 answer:
JulsSmile [24]3 years ago
6 0
It kills your performance

You might be interested in
18 POINTS
Maurinko [17]

Answer:

a animal that eats plants is a herbivore

8 0
2 years ago
Read 2 more answers
The medicare prospective payment system for reimbursing hospitals utilizes:
Marianna [84]
The medicare prospective payment system for reimbursing hospitals utilizes APCs.

APC stands for Ambulatory Payment Classifications that includes the outpatient payment system which is applicable only to the hospitals. There are different reimbursement methods for hospitals outpatients, inpatients, physicians, etc.
<span />
4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Rift valleys can form when fractures in the Earth's crust widen. The valley walls slowly move at a rate of only a few millimeter
Lilit [14]
My best answer would be C I hoped I helped sry if you get it wrong
4 0
3 years ago
Read 2 more answers
The best term to describe the general process by which microorganisms cause diseases is known as
jenyasd209 [6]
<span>Infection is the term used to describe the process through microorganisms that cause diseases. The invasion of a host by a pathogenic microorganism multiplies in the tissues and the reaction of the host to its presence and to its possible toxins and can be caused by bacteria, fungi, viruses, protozoa or prions.</span>
7 0
3 years ago
Other questions:
  • Which cell structure is correctly paired with its primary function?
    7·1 answer
  • The first process of cellular respiration that is anaerobic and produces 2 ATP?
    7·2 answers
  • Question 24 2 pts
    7·1 answer
  • How can mutation in a gene lead to a new trait in an organism ?
    8·2 answers
  • When measuring for pH, you are measuring for the presence of these ions?
    15·1 answer
  • Which of the following is true about structures of axons and muscle cells in order for the nerve impulses to stimulate muscle co
    9·1 answer
  • You learned in the previous section that archaea have ribosomes, similar to eukaryotes. How does this statement support the theo
    15·2 answers
  • Male and female rabbit were placed in a deserted habitat with a good supply of water and food. which will most likely happen to
    10·2 answers
  • What does the sun do to the panel to make electricity?
    6·1 answer
  • What is the removal of water by the joining of monomers called
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!