1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mafiozo [28]
3 years ago
12

Which of the statements would BEST serve as a topic sentence for a paragraph?

Biology
2 answers:
kogti [31]3 years ago
7 0

Answer:

A)Walt Whitman changed the way Americans thought of poetry.

Eliminate

Explanation:

Your topic sentence needs to be broad and each sentence of the paragraph should get more and more specific. Kind of like an upside down triangle.

( I'm in high school taking college courses and  learned this from my college professor so I am very confident in this answer)

lora16 [44]3 years ago
4 0

Answer:IT IS NO ANSWER

Explanation:

You might be interested in
***please help.***
Fantom [35]

Answer:

1.  first part Gene expression is the process by which the instructions in our DNA are converted into a functional product, such as a protein. When the information stored in our DNA? is converted into instructions for making proteins or other molecules, it is called gene expression.  second part Double-stranded DNA consists of two polynucleotides that are arranged such that the nitrogenous bases within one polynucleotide are attached to the nitrogenous bases within another polynucleotide by way of special chemical bonds called hydrogen bonds.

2. Gene regulation is an important part of normal development. Genes are turned on and off in different patterns during development to make a brain cell look and act different from a liver cell or a muscle cell, for example. Gene regulation also allows cells to react quickly to changes in their environments.

3. Non-coding DNA sequences do not code for amino acids. Most non-coding DNA lies between genes on the chromosome and has no known function. Other non-coding DNA, called introns, is found within genes. Some non-coding DNA plays a role in the regulation of gene expression.

4 0
2 years ago
In recombinant dna experiments, what is used to cut pieces of dna and what joins the resulting fragments to form recombinant dna
jonny [76]

DNA fragments are cut out restriction enzymes (restriction endonucleases) and then joined together using enzymes called DNA ligases.

<span>Restriction enzymes are enzymes which recognize target sequences (recognition sites) and cuts DNA at or near those sequences.</span>

DNA ligase is an enzyme that connects the gap between the molecules (if they have matching ends).

4 0
3 years ago
Compare the properties of the parent and daughter cells in mitosis and meiosis and explain the reason for any differences.
katrin [286]
Mitosis - 48 chromosomes (diploid cells)
Meiosis - 24 chromosomes (haploid cells)

Diploid cells. Meiosis is the process of cell division by which involving gametes. Cell division is just the same for sperm and egg cells, but they have distinguishable descriptions and labels in the process. Spermatogenesis is for the males’ sperm cells and oogenesis is the process for females’ egg cells. The cell division of meiosis involves the two phases, respectively meiosis I and meiosis II. Meiosis I like mitosis is the cell division that produces diploid cells<span>. These diploid cells are cells that contain a complete pair of chromosomes which is 46. The result is two diploid cells after the first meiosis. To provide clear explanation, in contrast haploid cells only contain 23 chromosomes and are created after meiosis II which is 4 in number.</span>
7 0
3 years ago
List at least four characteristics of acids
GalinKa [24]

Answer:

1. Aqueous solutions of acids are electrolytes, meaning that they conduct an electrical current.

2. Acids have a sour taste.

3. Acids change the color of certain acid-base indicators.

4. Acids react with active metals to yield hydrogen gas.

Explanation:

I looked it up.

5 0
3 years ago
Give the full form of ISP ​
natima [27]
The full form of ISP is, Internet service provider (ISP), company that provides Internet connections and services to individuals and organizations. ISPs are all connected to each other through network access points, public network facilities on the Internet backbone.
4 0
2 years ago
Other questions:
  • The nurse is caring for a patient on a ventilator. what measures can a nurse take to prevent development of barotraumas in such
    13·1 answer
  • Which group of living things can move energy from consumers at the top of an energy pyramid back to producers at the bottom? *
    6·2 answers
  • How do the daughter cells compare to the parent cells ?
    15·2 answers
  • All of the energy that drives earths Rock cycle comes from what
    14·2 answers
  • Which of these would you be most likely to find in a swamp?
    15·2 answers
  • Which of the following statements about weathering is true?
    15·1 answer
  • What is a non living part of the ecosystem
    11·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • What is the pattern of daylight at different times of the year?
    7·1 answer
  • HELP ASAP will give brainly
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!