1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga2289 [7]
3 years ago
10

Sulfur combines with atmospheric ______ to form sulfuric acid.

Biology
1 answer:
JulsSmile [24]3 years ago
3 0
Water vapor , you need a liquid to have acid rain-(rain is water btw) 
You might be interested in
Kaleb has extensively resistant tuberculosis (tb). treatment for extensively resistant tb would include
klemol [59]

Extensively drug-resistant tuberculosis is a form of tuberculosis which is caused by bacteria that are resistant to some of the most effective anti-TB drugs such as isoniazid and rifampin. This form of tuberculosis occurs due to an individual’s mismanagement of multidrug-resistant TB. Treatment for extensively resistant TB would include medication with at least two drugs to which the TB is susceptible.






7 0
3 years ago
How does aerobic respiration relate to photosynthesis
jonny [76]
Deathth creates lifethh
6 0
3 years ago
What must happen to the agent of erosion (wind or water) in order for deposition to occur?
Gnoma [55]

I am pretty sure that it is D

With decomposition, the final deposition of particles(sediments) usually occurs at the mouth of a stream. Then a process called horizontal sorting occurs where the sediments that were once carried down are arranged from big to small. Decomposition in streams takes time so the speed of the water and wind should not affect it nor should gravity or the direction. Streams cannot change direction either unless human involement occurs

Hope this helps :)

8 0
3 years ago
Summarize your findings in a scientific report. Include your hypothesis, observations, data, and conclusions. Be sure to answer
quester [9]

Answer:

Information and a couple of other people who is interested in taking up and taking a role away the home.

Explanation:

ami koice amar apnara thara dakta the the beautiful studies you speech block ever the thing studies opportunity for the next level ta the first thing that I have to go shafil is the right answer which is why it was worse than usual in order for my sister henna video games and the family is the comparative narrow and the family will not complete this picture I have to call the police and they said they would be found by him.

3 0
2 years ago
In horses, when chestnut stallion (CC) is crossed with an albino mare (AA), the offspring are palominos (CA). However, albino ho
defon

Answer:

it is better to bread with a chest nut

Explanation: because u get to make an albino horse and there cool and but they dont have the same things

3 0
3 years ago
Other questions:
  • He device that uses electrodes placed on the outside of the skull to record electrical activity within the brain, and is used in
    11·1 answer
  • Every time there is a full moon, Mrs. Cook insists that students in her classes display strange behavior. What would be the best
    11·1 answer
  • explain the how protein contained in seeds or milk is useful for the plant sprouting from the seed or the baby mammal
    10·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The stage of cellular respiration called______
    13·1 answer
  • Blood returning to the heart from the pulmonary circuit first enters the __________.
    14·1 answer
  • Help plz i will do anything
    9·2 answers
  • The lysosome is formed from
    8·1 answer
  • Why do we use specific terminology when referring to the gender and species of common domestic animals?
    15·1 answer
  • Hello i need help again
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!