1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelechka [254]
3 years ago
10

Are wings on birds a structural adaptation?

Biology
2 answers:
Ann [662]3 years ago
6 0
Yes because in order to survive the adapted and grew wings
Ksju [112]3 years ago
5 0

Answer:

yes.

Explanation:

You might be interested in
A person with AIDS may take longer than a healthy person to recover from a Salmonella infection.
Nadusha1986 [10]
In HIV-infected patients, there is a gradual loss of CD4+ T cells over time. These cells, also called T helper cells, organize the immune system's attack on disease-causing invaders, like Salmonella.
6 0
3 years ago
The domestic dog, Canis lupus familiaris, has 39 pairs of chromosomes in each of its diploid somatic (body) cells. Therefore, th
Fed [463]

Answer:39 chromosomes

Explanation; meiosis is a form of nuclear division that produces gametes with half the number of chromosomes in the parent cell.it involves two successive divisions to produce four daughter cells.meiosis occurs only in reproductive cells.

In this case,the dog has 39 pairs of chromosomes,which is 78 chromosomes.it would undergo meiotic division to produce the half number of chromosomes,which is 39 chromosomes.this 39 haploid chromosomes are contained in the sperm cells or in the egg cells.

When the egg and sperm fuses,the diploid number of chromosomes is restored.

6 0
3 years ago
What Are the process of photosynthesis and cellular respiration produces?
VikaD [51]

photosynthesis produces oxygen and glucose as the end products whereby the glucose is used as food by plants and oxygen as a byproduct.

cellular respiration produces water and carbon dioxide and the end products and by products where by energy is stored

7 0
2 years ago
A group of six students has taken samples of their own cheek cells, purified the DNA, and used a restriction enzyme known to cut
prohojiy [21]

Answer:

D. The two students who have two fragments have one restriction site in this region.

Explanation:

The DNA samples from the cheek cells were subjected to digestion with a restriction enzyme. This enzyme is an endonuclease and cuts the DNA at a specific sequence only. This sequence is called a restriction site. If the restriction site is not present in the sample DNA, the restriction enzyme cannot cut it. The presence of one restriction site in the sample DNA would cut it into two DNA fragments.

Similarly, the presence of two restriction sites in each DNA molecule would obtain a total of three DNA fragments per DNA molecule.

3 0
3 years ago
Fill in the blanks with the answer that correctly completes the sentence below.
Andre45 [30]

Answer:

C. Amoebae and paramecia is the answer.

Explanation:

7 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • When caring for a patient who takes numerous medications, it is best to:
    11·1 answer
  • In one type of dog, black spots (B) are dominant over brown spots (b) and long tails (L) are dominant over short tails (l). Use
    8·2 answers
  • Collecting material, isolating key points, and selecting visual aids occurs at which stage of the briefing process? ssd1 module
    14·1 answer
  • Which is an ex sample of the use of plants in human society
    12·1 answer
  • 26. Which scientist(s) observed changes in the characteristics of animals
    11·1 answer
  • Taking antibiotics for viral infections has no positive impact on individual health because viruses are not killed by antibiotic
    14·1 answer
  • What is the overall purpose of meiosis?
    13·1 answer
  • Does the stratosphere have a high or low temperature also what is the temperature
    13·1 answer
  • Help please!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!