1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kaheart [24]
3 years ago
8

Which heat-induced condition is treated by removing clothing and getting the patient into a tub of cool water?

Biology
1 answer:
vovikov84 [41]3 years ago
8 0
<span>Heat strokeHeat stroke is a condition caused by failure of the body's temperature-regulating mechanism when exposed to high temperatures. Heat stroke is treated by keeping the body temperature less than 102.5°F. Various cooling methods includes removing clothing, placing the patient in front of a large fan, and immersing the patient into a tub of cool water.
</span>
You might be interested in
Which structure in the female reproductive system is comparable to the external reproductive organs in males?
SVEN [57.7K]
I thing it is the Vulva
4 0
3 years ago
Read 2 more answers
How do roots provide water for the plant
olganol [36]

Answer:

The roots suck up the water in the ground. Then transfer it to the plant.

Explanation:

6 0
2 years ago
Read 2 more answers
What process do plants use to remove carbon dioxide from the air?
Oksi-84 [34.3K]
Photosynthesis for sure
6 0
3 years ago
What does it mean that a hypothesis must be testable? can a hypothesis be proven unquestionably true? why or why not?
katen-ka-za [31]
A testable hypothesis must be just that--testable. You must be able to provide evidence that your hypothesis can be proven true in order for it to be considered accurate enough for future use among scientists. This can be done through repeated experimentation.
8 0
3 years ago
Read 2 more answers
Which of the following cell components are most involved in determining an organism’s traits?
kati45 [8]

Answer:

I believe its B or D

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • The ability to obtain nutrients, take in oxygen, and transform these items to energy and cellular components is called _____.
    11·1 answer
  • When insulin binds to its receptor, the complex is endocytosed into the cell. This is an example of ______ in response to hormon
    14·1 answer
  • A smoker sees his doctor because he had a persistent cough for months and is short of breath after very little exertion. what di
    7·1 answer
  • What is the actual temperature 3000km below the surface of the Earth?
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which forms of self-injury (si) are most common?
    7·2 answers
  • What are some ways that living things can be classified? What characteristics should we look at when putting living things into
    7·1 answer
  • A greyhound dog can run 40 mi/hr is this speed, velocity, or acceleration
    9·2 answers
  • Hydrocarbons are not very soluble in water because
    6·1 answer
  • How could you increase the magnitude of excitatory postsynaptic potentials (EPSPs) generated at a synapse? A. Increase sodium-po
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!