Describe the life cycle, from birth to death, of a star that is similar in mass to our sun

Biology

1 answer:

mezya [45]3 years ago

6 0

Here this may help you alot

You might be interested in

How does crossing over affect evolution?

Free_Kalibri [48]

<em>crossing-over affect evolution...
<u>reason:
</u>during crossing-over chromosomes exchange their genetic information...
because of this variations occur in new generation,, in new generation some characters are from maternal chromosomes and some are from paternal chromosomes... </em>

5 0

3 years ago

Which statement best explains how the structure of atp helps provide energy to the cell?

Alekssandra [29.7K]

Answer:

ATP contains energy in the chemical bonds between its phosphate groups, best explains how the structure of ATP helps provide energy to the cell.

Explanation:

brainly.com/question/2456485

4 0

3 years ago

Please help me with these ones ill mark u as the best answer if correct

miss Akunina [59]

Answer:

option D,A,D,

Explanation:

6 0

3 years ago

How do I do cell structures help the mitochondrion obtain the necessary nutrients it needs to perform its function within the ce

Natalija [7]

Mitochondria have two membranes, an outer membrane and an inner membrane. ... It is also where many other chemical reactions take place to carry out the mitochondria's many functions. An increased surface area creates more space for more reactions to occur, a

3 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago