1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xz_007 [3.2K]
3 years ago
7

Things of the same species have similar morphology and can _____.

Biology
1 answer:
motikmotik3 years ago
4 0

Interbred is the answer

You might be interested in
In which biome would you most likely find plants that grow far apart from one another, with narrow leaves and shallow roots? Why
stiks02 [169]
<span> A plant with narrow leaves and shallow roots would probably be found in the desert, where there is not a lot of water. Narrow leaves help prevent water loss. Shallow roots can spread out long distances in search of water. Plants living in the desert grow far apart from one another so that they don’t have to compete for limited amounts of water.</span>
8 0
3 years ago
Read 2 more answers
Some materials can move across the cell membrane against a concentration gradient by
Anastasy [175]

Answer:

Molecules which move against the concentration gradient across the cell membrane employ the mechanism of active transportation.

Explanation:

Normally, permitted molecules moves across the cell membrane of the cell by the process of diffusion and osmosis. This is used when molecules move from hypertonic region to hypotonic region (if ions) and hypotonic to hypertonic (if water). This is a passive transportation which do not require the expense of energy from the cell.

In contrast, when molecules move in or out of the cell against their concentration gradient, that is ions moving from hypotonic region to hypertonic region, they implore the expense of energy in form of adenosine triphosphate (ATP), and the involvement of the membrane carrier proteins. This is called active transport.

7 0
3 years ago
Describe how you should warm up before attempting a maximal test.
nikitadnepr [17]
Sit in front of a heater- what are the options

3 0
3 years ago
Read 2 more answers
Describe how cooperativity of oxygen binding in hemoglobin is advantageous for the transport of oxygen from the lungs to the tis
Nostrana [21]
The affinity of hemoglobin for oxygen is less than its structural analog myoglobin. However, this does not affect hemoglobin's usefulness for the body; on the contrary, it allows hemoglobin to be a  more efficient carrier than myoglobin. This is because hemoglobin can release oxygen more easily than can myoglobin. It is both important for oxygen to be carried to different areas and also to be released when needed. The higher affinity of a given protein for oxygen, the harder it will be for that protein to release oxygen when needed. Therefore, hemoglobin's lower affinity for oxygen serves it well because it allows hemoglobin to release oxygen more easily in the body. 
3 0
3 years ago
Which letter correctly identifies telophase
slava [35]
The word phase  means to change a part of a development
5 0
4 years ago
Read 2 more answers
Other questions:
  • Jennifer’s children have always been short when compared to their classmates. One day her son blurted out, "I can’t wait until I
    5·1 answer
  • What do all living things have in common with eachother
    6·2 answers
  • Which of these is composed of organic compounds?
    8·2 answers
  • What is the result unit if you divided<br> 1 kg • m/s2 by 1kg
    6·1 answer
  • An individual sustains injuries to only the ascending tracts of the spinal cord. Will this person experience deficits in movemen
    8·2 answers
  • Analyze the following DNA sequence: A T G C G A T C T A G C
    14·1 answer
  • Earth’s surface features slowly change over time. For example, sharp, jagged mountain ranges become lower and more rounded over
    11·1 answer
  • How are monosaccharides made from a disaccharide ?? And what’s the reaction called ?
    6·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Drag and drop each word or phrase into the type of olate boundary it describes
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!