1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sp2606 [1]
3 years ago
8

How are tumors cells different from normal cells

Biology
2 answers:
bulgar [2K]3 years ago
6 0

The big difference is growth. Normal cells stop growing when there are enough in one spot.

For example: When you get a cut, cells go to heal the wound, and the cells grow. But when the work is done, the cells stop growing.

But, cancer/tumor cells (not at a wound) grow and grow even when touching the first layers of muscle and skin. This would be what creates the lump. So, these bad cells are very overgrown and practically swollen cells.

:)

lisabon 2012 [21]3 years ago
5 0
Tumor cells differ from regular healthy cells in their growth patterns, life cycles and methods of intercellular communication. they vary in their sizes. tumor cells are able to grow undetected by the body’s immune system.
You might be interested in
Based on this video, the definition for an Invasive Species is a ...
irinina [24]

Answer:

Option 2

Explanation:

I did not see the video referenced, but an invasive species is not always brought by people. Furthermore generally there are no limiting factors because it has no natural predators in the environment and often uses up all the resources in that particular environment. Hope this helps!

8 0
3 years ago
1. How can we identify a market for vegetables? Write.
Ratling [72]

1.

Marketing is one of the most important factors in determining the success of any fruit and vegetable farming enterprise. Marketing includes all the operations and decisions made by producers. These decisions range from deter-mining the most marketable crops for production to deciding how to best deliver quality produce to the consumers at a profit. However, contrary to popular belief, marketing does not begin after a crop is produced. Instead, marketing alternatives need to be considered even before production takes place.

2.

Recent environmental and food safety concerns in the United States produce sector have brought about increasing interest in organic fruit and vegetable production as an alternative to traditional fruit and vegetable enterprises. As a result, the production and marketing of organic crops has expanded steadily during the 1980s. However, as more organic producers enter the industry and it becomes more and more competitive, existing producers are forced to become better growers and more effective marketers.

5 0
3 years ago
What are we doing to for remedy for a F.O.G?
MAVERICK [17]

Answer:

i need more details to answer.

Explanation:

sorry

3 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
During which phase does a cell usually leave the cell cycle
vodka [1.7K]

Answer:

mitosis

Explanation:

7 0
4 years ago
Read 2 more answers
Other questions:
  • During periods of vigorous physical activity, a person's breathing and heart rates increase. This enables the cells of the body
    11·2 answers
  • <img src="https://tex.z-dn.net/?f=5%284x%20%2B%203%29%20-%203%287x%20-%202%29" id="TexFormula1" title="5(4x + 3) - 3(7x - 2)" al
    13·1 answer
  • Data from a Burger et al. (2004) indicate that mercury levels in Florida gar, top-level predators, from Lake Okeechobee were not
    6·1 answer
  • Can the energy, in an ecosystem, flow forwards and backwards?
    8·2 answers
  • Question 9 of 10
    10·1 answer
  • What is the valence of an atom with six electrons in its outer electron shell?
    11·1 answer
  • What is inside the cells​
    5·2 answers
  • A coiled structure of DNA and protein that forms in the cell nucleus during cell division is
    8·2 answers
  • PLEASE HELP WITH THIS ONE QUESTION
    9·2 answers
  • What kind of weather typically comes with a cold front?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!