1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shtirl [24]
3 years ago
13

List controllable factors that increase the risk of cardiovascular disease.

Biology
1 answer:
Alchen [17]3 years ago
4 0

Answer:

smoking

diet

physical activity

stress

Explanation:

You might be interested in
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
What is a simple definition of Natural selection? I do not understand dictionary description.
SashulF [63]
Natural selection is the process where organisms that are best suited to their environment survive and pass on their genetic traits in increasing number to successive generations. At the same time, organisms that are less adapted fail to survive or multiply at a lower rate, and tend to be eliminated from the ecosystem.
5 0
3 years ago
What would the order be
MariettaO [177]

genome chromosome gene base pair

5 0
3 years ago
Locate Bible verses associated with our stewardship of the earth and rewrite each Bible verse using one's own interpretation
stiv31 [10]

Answer:

1 corinthians 4: 2

What administrators are asked to do is be faithful

1 Peter 4: 10

Each person must use the gifts that have been granted for a good administration of the charism of God

1 Timothy 5: People who do not care about their family or those who live with them reject the faith and are worse than unbelievers

Colossians 3:23: All the works we do are done for God and not to please other people

1 Corinthians 4: 1,2 May people see us as servants of Christ and stewards of the mysteries of God, likewise we are asked to be good stewards

3 0
3 years ago
What is algin?
Fittoniya [83]
C. A substance produced by brown algae used to thicken foods
6 0
3 years ago
Read 2 more answers
Other questions:
  • The amount of time spend in the bathtub and the temperature of the bath water
    8·1 answer
  • Work a punnett square for a father who is type A heterozygous and the mother is type B heterozygous.
    10·1 answer
  • In pea plants, purple flowers (“P”) are dominant to white followers (“p”). A white-flowered plant is crossed with a plant that i
    12·1 answer
  • The first law of thermodynamics states that ___
    7·1 answer
  • Which of the following are considered micro molecules? Select all that apply.
    15·1 answer
  • Chains of glucose make up?
    10·1 answer
  • Red-green color blindness is caused by an x-linked recessive gen. In a family, the mother is a carrier of this gene while the fa
    13·2 answers
  • The Precambrian time period is the largest on the geological time scale. Please select the best answer from the choices provided
    6·1 answer
  • 20. A specific enzyme is involved in a certain body reaction. What will most
    10·1 answer
  • Question 5 of 30
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!