1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zepler [3.9K]
3 years ago
5

​NEED ASAP

Biology
2 answers:
weqwewe [10]3 years ago
7 0

Answer:

may produce seeds - plants only

are heterotrophic - fungi only

may have aseptate hyphae - fungi only

can absorb nutrients from soil - plants only

may have rhizomes - plants only

can photosynthesize - plants only

have cell walls - both plants and fungi

Explanation:

Fungi and plants are two distinct groups of eukaryotic organisms. They possess different structures and characteristics and also have one or few in common. The characteristics in the question will be used to explain which organisms between fungi and plants it belongs to:

- Some plants reproduce sexually by fusion of their gametes. Production of seeds is a unique process that only plants have. Plants are the only organisms that propagate via seeds. Fungi do not produce seeds.

- Heterotrophs are organisms that are incapable of producing their own food, hence, they rely on other organisms for food source. This is a characteristics of fungi only because plants are autotophic organisms and hence can synthesize their own food via the process of photosynthesis.

- Hyphae is a long filamentous structure that collectively forms the mycelium in Fungi. It can be septate (have walls) or aseptate (without walls). It is unique to only Fungi species and plants do not possess this feature.

- Plants absorb water and nutrients from the soil via their roots. Fungi cannot absorb directly from the soil. They absorb from Plant and animal matter around them.

- Rhizomes are horizontal underground stems that forms roots and shoots from its node. It is a feature of some plants like onions, ginger etc. Fungi do not have or produce Rhizomes.

- Photosynthesis is the process whereby food is synthesized using energy from the sun. It is unique to autotrophic organisms like plants, that possess pigments like Chlorophyll which they use to trap light energy from the sun. Fungi is an heterotroph and hence cannot photosynthesize.

- Fungi and plants both have cell walls in their cells. The cell walls of fungi and plants are made up of chitin and cellulose respectively. Hence, cell wall is a feature of both organisms.

Tatiana [17]3 years ago
3 0
These are the characteristics of a plant. Fungi do not photosynthesize.
You might be interested in
PLEASE HELP IM TIMED!!!!! which type of energy refers to the sum of potential and kinetic energies in the particles of a substan
wolverine [178]
The answer that’s correct is The letter C
5 0
3 years ago
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
All geologic eras are about the same number of years.<br> True or false
rodikova [14]

Answer:

false

Explanation:

6 0
3 years ago
Read 2 more answers
Plzz help
Sedaia [141]

Answer:

b

Explanation:

8 0
4 years ago
Because enzymes have high specificity, fewer than fifteen are required by any organism.
Ira Lisetskai [31]
This is a false statement. 
3 0
3 years ago
Other questions:
  • Suppose you observed 455 individual cockroaches in the infested apartment after 5 years of exposure to hydramethylnon + glucose
    6·1 answer
  • How could you tell if a sample of matter is an element
    5·2 answers
  • Most energy sources are derived from the Sun's energy. True False
    6·2 answers
  • What is a reason why viruses could be considered abiotic and biotic?
    11·1 answer
  • The nucleus is a structure that surrounds a cell and helps control what enters and exits the cell.
    6·1 answer
  • PLEASE HELP! What property was used as evidence to support seafloor spreading?
    8·2 answers
  • There are many costs associated with owning and driving a car. There are maintenance costs, fees, tolls, taxes, fuel, and insura
    10·1 answer
  • Describe two major differences between the appearance of granite and basalt
    15·2 answers
  • What two substances among four major types of organic compounds are made by living things? A.carbohydrates
    10·2 answers
  • Which statements describe the importance of the nitrogen cycle to living things? Select two options. It provides a source of wat
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!