1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masteriza [31]
3 years ago
10

Measuring the height of a plant is an example of _____ data

Biology
1 answer:
alex41 [277]3 years ago
5 0

Measuring the height of a plant is an example of quantitative data

Answer: Option C

<u>Explanation:</u>

When there is an experiment performed there are 2 types of data that can be recorded one is a qualitative data and quantitative data. Qualitative data is a type of data that describes the quality of the product formed whereas the quantitative data is a data that quantitative the numerical values that we get through the experiment. A quantitative data is more authentic than a qualitative data as it provides figures for comparison.

You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Identify Whether the flu is a viral or bacterial in nature.
Ber [7]
Virus are considered to be non living
No antibiotics won’t be helpful towards influenza virus it can inturn result to antibiotic resistance
Flu is viral
6 0
3 years ago
Read 2 more answers
What did Galileo think the bulges on either side of Saturn were cause by?
joja [24]
He thought that they were moons
but it was actually the rings of the planet
8 0
3 years ago
Describe the chemistry of amino acids that make up a transmembrane protein
AnnyKZ [126]
Characteristic of many trans-membrane proteins is the presence of tyrosines and tryptophans at the aqueous interface .These amino acids serve as interfacial anchors that can interact simultaneously with the membrane hydrophobic interior and the aqueous exterior.
3 0
2 years ago
Question
Korvikt [17]
I believe it is D solid to gas
8 0
3 years ago
Other questions:
  • In the heart, one ventricle pushes blood with oxygen to the cells of the body. Where does the other ventricle push the blood wit
    10·2 answers
  • A — is a protein that recognizes and responds to a signal
    13·1 answer
  • When a piece of food contact equipment is in constant use it should be cleaned and sanitized every?
    15·1 answer
  • What type of biomedical engineer typically works in medical settings, maintaining diagnostic and therapeutic devices and aids an
    12·2 answers
  • Which is NOT an abiotic factor? <br> moisture<br> flowers<br> temperature<br> pressure
    11·2 answers
  • When the immune system attacks the body`s own cells, it produces an _________. disease.
    8·1 answer
  • explain what DNA is and how the model of DNA developed .You should include information on how genetic information is carried ,as
    14·1 answer
  • Which of the following is a decomposer?<br><br> A.wolf<br> B. Worm<br> C.banana<br> D. Fern
    12·2 answers
  • una bola en movimiento es golpeada por el bateador y cambia su dirección de movimiento. que ley de movimiento neutrón es.​
    12·1 answer
  • Which of the following statements is correct about bound ribosomes?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!