1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vovikov84 [41]
3 years ago
7

The work cited page list citations in the following order

Biology
1 answer:
Svetllana [295]3 years ago
4 0

Answer:

Explanation:

You list the references in order of the last name of the author. For instance a book by Zachary Adam would come before a book by Adam Zachary. (Just an example)

Adam, Zachary. "Works Cited Example 1." Place of Publication: Publisher, Year.

Zachary, Adam. "Works Cited Example 2." etc.

You might be interested in
Part i
evablogger [386]

Answer:

              1. When a rubbed ruler is brought close to the paper, salt and pepper they are not equally attracted as paper is lighter than pepper and salt, so it takes less effort for paper to overcome the force of gravity.

2. electrostatic induction is a phenomenon in which static electricity is generated in an object by bringing an electrically charged object near it. When a charged object is brought near to an uncharged body it causes electrical charges to redistribute in the body, resulting one side having excess of positive charges and other side having negative charges, as a result body become charged.  Electrostatic interaction also depends upon the nature and mass of body.  

b. the combination of fur cloth and rubbed ruler produce greatest effect. The reason is that when ruler is brought near to fur excess of electron will flow into fur.


7 0
3 years ago
Help this is due tomorrow
Zinaida [17]

Answer:

chicken wit a bagel

Explanation:

you see the chicken got a bagel

8 0
2 years ago
Read 2 more answers
Which statement correctly describes the transfer of energy between the blue arrows?
lapo4ka [179]
Show the statement. (A picture or an example of the problem)
3 0
2 years ago
Which of the following best describes how
miv72 [106K]
Can you list options since its which of the following?
6 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • The particles that make up a rock are constantly in motion. However, a rock does not visibly vibrate. Why do you think this is?
    12·1 answer
  • Where would a new star most likely form?
    10·1 answer
  • What term is used to describe the state in which molecules are evenly distributed in the available space?
    14·1 answer
  • What are the conditions required for natural selection? Check all that apply.
    12·2 answers
  • Is a scar an inherited or an environmental change?​
    14·1 answer
  • What type of muscle is responsible for contractions of the digestive tract and arteries?
    5·1 answer
  • Consider the equation S + O2 ? SO2. What is the product? Question 3 options: S SO 2 S + SO 2 O 2
    8·1 answer
  • Why DNA needs to be replicated
    7·1 answer
  • Which form of precipitation is water that falls as chunks of solid ice?
    13·2 answers
  • Which of the following is NOT a characteristic of botrytis?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!