1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Black_prince [1.1K]
4 years ago
7

Match the reactant in gluconeogenesis with the appropriate enzyme.

Biology
1 answer:
serg [7]4 years ago
3 0

Answer: a c g e

Explanation:

You might be interested in
There are many different types of touch receptors (hot, cold, etc.) in the skin, and these different types of receptors are not
Gre4nikov [31]

Answer:

It is true.

Explanation:

Throughout the skin, there are sensitivity receptors, no matter what sector we look for.

The difference is that there are areas of higher density.

Places like the hand and fingers are the ones that help us explore and know things. The number of receptors there is much greater than in areas such as the back or neck.

5 0
4 years ago
What is the factors ofmedications that make a person more susceptible to acquiring an infection
irina1246 [14]

Answer:

Medications that can increase the chances of getting a fungal infection

Budesonide (Entocort EC)

Cortisone (Cortone)

Dexamethasone (Decadron)

Hydrocortisone (Cortef)

Methylprednisolone (Medrol)

Prednisolone (Prelone)

Prednisone (Deltasone)

Triamcinolone.

5 0
3 years ago
The human circulatory system is described as a double-loop system. What are the functions of the two loops? Select two answer ch
notka56 [123]

Answer:

A. and C

Explanation: experience :)

3 0
4 years ago
Is Sirius B brighter or dimmer than the sun ?
Lorico [155]
Sirius B is brighter than the sun.
5 0
3 years ago
Read 2 more answers
What is the difference between plant cells and animal cells<br>​
marin [14]
A plant cell contains a large, singular vacuole that is used for storage and maintaining the shape of the cell. In contrast, animal cells have many, smaller vacuoles. Plant cells have a cell wall, as well as a cell membrane. ... Animal cells simply have a cell membrane, but no cell wall.
4 0
4 years ago
Read 2 more answers
Other questions:
  • What has characteristics that are most like an action plan? A) textbook B) newspaper c) cookbook D) Road map? Please help me
    14·2 answers
  • he hormone oxytocin Select one: A. increases a woman's appetite during pregnancy. B. reduces the ability of blood to clot during
    12·2 answers
  • For a thirsty person, drinking water serves to reduce a basal metabolic rate. b homeostasis. c an instinct. d the set point. e a
    9·1 answer
  • Gary hears the words candy, sweet, and sugar. The next thing Gary thinks is cookie. Gary has experienced:
    11·1 answer
  • Oxygen is denoted as . How many protons and neutrons does an oxygen atom have? A. 16 protons and 16 neutrons B. 8 protons and 8
    6·2 answers
  • The movement of birds is called____. The change in the pattern of movement of birds suggest ___.
    11·2 answers
  • During mitotic cell division, _____ daughter cells are produced that are genetically _____ their parent cells
    9·2 answers
  • How many times more ATP can be formed by an electron transport chain than can be formed by a citric acid cycle?
    10·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • In humans there is approximately 30% adenine (A). What is the percentage of each of the other 3 DNA bases?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!