1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NeX [460]
3 years ago
5

A lipid that the body requires to make several critical substances but can’t synthesize on its own is _____.

Biology
1 answer:
Reptile [31]3 years ago
7 0
The term that is being referred to in the given item above is essential lipid which other may more fondly refer to as essential fatty acids. These essential substances are mostly needed for the maintenance and integrity of the cellular membranes to be able to do their functions. 
You might be interested in
Ribosomes are the site where— are produced.
jolli1 [7]

Answer:

Ribosomes are the site where proteins are produced. Amino acids are coded for by triplet bases in RNA called codons

Explanation:

4 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
UIZ
Keith_Richards [23]

Answer:

<em>The correct option is C) A mouse and a human have about the same number of genes.</em>

Explanation:

The technique of genetic sequencing has enable us to learn and compare thee genomes of different organisms. Genome sequencing proves that the genome of the humans and mice are about 99 percent similar. The number of genes in the mouse genome and the genome of humans is almost equal.

Other options, like option A, cannot be true because many complex organisms have fewer chromosomes than other organisms. For example, there are many simple plants which have more number of chromosomes than the complex humans.  

6 0
3 years ago
Which statement best explains why less energy is available to organisms as a food chain gets longer?
Aleks [24]
<span>This is due to much of the energy that is consumed by lower trophic levels of the food chain/food web being used at that lower level. This energy is stored or used and, therefore, unavailable to the organisms higher up in the chain. As the chain lengthens, less energy is available, usually as a factor of 10 (1/10 of the energy taken in by the level below the consumer is available to the consumer's level, for example).</span>
4 0
2 years ago
Read 2 more answers
Hello! Could someone please answer this question because I have a test tomorrow. Okay, how are ions formed?
konstantin123 [22]

ions are electrically charged particles formed when atoms lose or gain electrons

5 0
3 years ago
Other questions:
  • What is the main functions of lipids?
    11·2 answers
  • Least common multiple of 5and 25
    7·2 answers
  • What is energy?grade 8
    9·1 answer
  • What do fires, hurricanes, and other natural disturbances result in?
    13·2 answers
  • An observation that describes without using numbers or amounts is a
    14·1 answer
  • In photosynthesis, redox reactions ultimately transfer electrons from ______ to ______.
    12·1 answer
  • What is the difference between a virus and bacteria in causing infection?
    13·1 answer
  • Which is most likely to change with new discoveries and technologies?
    13·2 answers
  • If you help I'll give you a brain list
    10·1 answer
  • In a _______________________ av junction, the impulse will reach the atria and the ventricles simultaneously, so the p wave is h
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!