1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lorico [155]
3 years ago
12

DNA replication involves several steps. First, the enzyme, helicase, unwinds the hydrogen bonds of the DNA double helix. Then DN

A polymerase attaches the complementary nucleotides thereby creating two semi-conservative strand of identical DNA. Semi-conservative replication of DNA refers to the idea that
DNA molecules need to unwind before duplication can begin.


each new DNA molecule contains two new single RNA strands.


the identical two strands of DNA molecules run in opposite directions.


two identical DNA strands contain part old and now part new nucleotides.
Biology
2 answers:
BaLLatris [955]3 years ago
5 0

Answer:

The process is catalyzed by enzymes called DNA mutagens.

Explanation:

kari74 [83]3 years ago
4 0
<span>the identical two strands of DNA molecules run in opposite directions.</span>
You might be interested in
Why do you think not assess motor, sensory, and circulatory function before and after splinting would be a critical fail?
katrin [286]
In fracture patient, splinting is beneficial as it could prevent damage to the vascular and nerve tissue by immobilizing it. But splinting is also dangerous. To immobilize the extremity, splint needs to be put with enough force.  This force often can cause damage as it could block the arteries that run in the extremity, causing ischemia. 
It is important to do the assessment before and after splint to make sure the splint doesn't cause damage to the patient.
7 0
3 years ago
What part of Isaac Newton’s childhood led him to become so defensive and hostile toward any criticism of his work?
ELEN [110]

Answer: Issac became stubborn and defensive because of the fierce nature of siblings and commanding nature of his second father and mother. Due to the stubbornness of his family member he had to leave his study in early childhood and engage in farming which he left ultimately to pursue higher studies.

Explanation:

3 0
3 years ago
Read 2 more answers
When a cold can of soda is insulated, the heat flow into the can on a hot day ____.
maksim [4K]
The word insulate means to protect from heat, cold,...
So when a can is insulated, means that is protected from heat.
So the answer is:
C. stays the same :)))
I hope this is helpful
have a nice day
4 0
3 years ago
Read 2 more answers
Heeeelpppp plzzzzzzzzzzzz
Annette [7]

Answer:

What is an allele.one of two or more alternative forms of a gene that arise by mutation and are found at the same place on a chromosome.

Explanation:

4 0
3 years ago
The density of sodium is 968 g/cm3. Suppose you need 250 gm of sodium for an experiment. Which volume of sodium do you need?
stealth61 [152]
I would say to divide 968÷250..I dk but iw would
4 0
3 years ago
Other questions:
  • With rare exceptions, enzymes belong to the major organic substance group called _____.
    11·1 answer
  • Why does a<br> vestigial pelvis show that<br> the ancestors of the modern<br> whale once had legs?
    5·1 answer
  • List 5 observations that would help an angler be successful
    6·1 answer
  • During DNA replication two identical DNA molecules are produced from one original molecule. Which statements below explains why
    14·1 answer
  • A 14-year-old has just had a plaster cast placed on his lower left leg. to provide safe cast care, the nurse should:
    6·1 answer
  • What cell parts are found only in plant cells? What are found only in animal cells?
    5·1 answer
  • A normal appearing couple is found to be heterozygous recessive for albinism. Both have the genotype Aa. The gene responsible fo
    15·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Three of the following statements are correct. Identify the statement that is not correct regarding genetically modified organis
    9·1 answer
  • Please choose one of the multiple choice answers
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!