Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
Answer:
Genes are segments of deoxyribonucleic acid (DNA) that code for a specific protein that works in one or more types of cells in the body. Chromosomes are structures within cells that contain a person's genes. Genes are contained in chromosomes, which are found in the cell nucleus.
I hope it helps you :3
Plants do not breathe, they only respire. No such respiratory organ os present in plants. The carbon dioxide produced in animals during respiration is released to the atmosphere, whereas the carbondioxide produced during plant respiration may be used by the plant for carrying out photosynthesis.
Answer:
Negative impact.
Explanation:
There is a negative impacts of sprawl on wetland ecosystems because it destroys the habitat of thousands of organisms. Making laws to restrict housing in a wetlands and avoiding making houses on the wetland are the ways to protect wetlands from further decline. Human activities is the main factor that causes harm to wetland ecosystem so sprawl has adverse impact on wetland ecosystem.
