1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Verizon [17]
3 years ago
15

Fungi have many uses including commercial uses. Which of these is a commercial use for fungi

Biology
1 answer:
Vladimir [108]3 years ago
5 0

Your answer is D.) All of the above

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Which of these phases is anaphase?<br>​
Nonamiya [84]

Answer:

D

Explanation:

A: Interphase = DNA replication, cells spend most of their time in interphase

B: Prophase = Chromatin condenses and becomes visible

C: <u>M</u>etaphase = Chromosomes line up in the <u>m</u>iddle

D: <u>A</u>naphase = Sister chromatids are being pulled <u>a</u>way

E: Telophase = Cleavage furrow forms

6 0
2 years ago
What are the building blocks of DNA And RNA
Paul [167]
The basic building block of DNA and RNA are Nucleotides.
3 0
3 years ago
Read 2 more answers
Helppppp boooo!!!!!
8090 [49]

By the first distance, I'd say Venus (0.72 AU)

By the second distance, I'd say it's Saturn (9.54 AU)

But you also say it has no visible rings so the answer is VENUS.

Hope it helped,

Happy homework/ study/ exam!

3 0
3 years ago
Read 2 more answers
Why would scientists may want to know if two plant species are closely related.
vaieri [72.5K]
2 related plants may produce similar substances that could be used for medicines
4 0
2 years ago
Read 2 more answers
Other questions:
  • Define organelle and explain what it is
    8·2 answers
  • What is the basis on which the subdivisions in a Geological time scale are made
    6·1 answer
  • Which is not an observation
    6·1 answer
  • Which enzyme is responsible for creating a primer that allows the dna replication process to start?
    15·1 answer
  • Which of these is an example of a crack in earths plates in which landforms on either side of the crack move past each other
    5·2 answers
  • A GG,BB and bb <br> B only GG and Bb <br> C only GB and Gb <br> D GB,Gb,gb and gB
    6·1 answer
  • List your favorite food chain/web, with examples and its environment.​
    9·1 answer
  • True or false glucose is the primary nutrient for all living things
    6·2 answers
  • 1 point
    11·1 answer
  • While Earth’s atmosphere contains greenhouse gases, Earth does not experience runaway warming, as on Venus, because
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!