1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
2 years ago
11

Phosphofructokinase is a four-subunit protein with four active sites. phosphofructokinase catalyzes step 3 of glycolysis, conver

ting fructose-6-phosphate to fructose-1,6-bisphosphate. phosphoenolpyruvate (pep) is the product of step 9 of glycolysis. the pep concentration in the cell affects phosphofructokinase activity. select the true statements about pep regulation of phosphofructokinase.
Biology
1 answer:
zaharov [31]2 years ago
8 0
<span>PEP is included in the regulation of phosphofructokinase (PFK). PFK is allosterically inhibited by PEP which means that PEP binds to PFK which results in a conformational change of PFK. As a result of this PFK is inhibited. High levels of PEP indicate a sufficient cellular energy supply and therefore there is no need for further glycolysis.</span>
You might be interested in
What's got shoes an no feet ​
sammy [17]

Answer:

a closet

Explanation:

3 0
2 years ago
Read 2 more answers
HELP!!! choose one of the following types of biotechnology: genetic engineering, cloning, or artificial selection. You will then
Darina [25.2K]

Answer:

Genetically modified organisms or GMOs can be characterized as living beings (for example plants, creatures or microorganisms) in which the hereditary material (DNA) has been changed in a way that doesn't happen normally by mating and additionally common recombination. The innovation is regularly called "present day biotechnology" or "quality innovation", now and again likewise "recombinant DNA innovation" or "hereditary designing". It permits chosen singular qualities to be moved from one life form into another, likewise between nonrelated species. Nourishments created from or utilizing GM life forms are regularly alluded to as GM nourishments.  

GM nourishments are created – and promoted – in light of the fact that there is some apparent bit of leeway either to the maker or customer of these nourishments. This is intended to convert into an item with a lower cost, more prominent advantage (regarding toughness or healthy benefit) or both. At first GM seed engineers needed their items to be acknowledged by makers and have focused on advancements that carry direct advantage to ranchers (and the food business by and large).  

One of the destinations for creating plants dependent on GM life forms is to improve crop insurance. The GM crops as of now available are fundamentally focused on an expanded degree of harvest security through the presentation of obstruction against plant infections brought about by creepy crawlies or infections or through expanded resilience towards herbicides.  

Resistance for insects is accomplished by consolidating into the food plant the quality for toxins creation from the bacterium Bacillus thuringiensis (Bt). This poison is presently utilized as an ordinary bug spray in agribusiness and is ok for human utilization. GM crops that inalienably produce this poison have been appeared to require lower amounts of bug sprays in explicit circumstances, for example where nuisance pressure is high. Infection obstruction is accomplished through the presentation of quality from certain infections that cause sickness in plants. Infection opposition makes plants less helpless to sicknesses brought about by such infections, bringing about higher harvest yields.  

Herbicide resilience is accomplished through the presentation of a quality from a bacterium passing on protection from certain herbicides. In circumstances where weed pressure is high, the utilization of such harvests has brought about a decrease in the amount of the herbicides utilized.

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
What piece of lab equipment is used to measure 10 grams of sand
nirvana33 [79]

Answer:

usually a scale used for grams

Explanation:

7 0
3 years ago
What type of organism is likely to live on a dead tree in a dense forest
allsm [11]

The answer is; raccoons and rodents

Racoon will burrow in the soil or tree logs and form a den where they can litter. When threatened, the raccoon can retreat to its hideout or climb a tree. Rodents also scrawl the bottom of the forest finding food. They also love to burrow or hide in crevices of fallen tree trumps or rocks.


6 0
3 years ago
Other questions:
  • Seafloor spreading occurs at __________ boundaries divergent convergent transform transvergent
    11·1 answer
  • Sarah finds herself in the middle of the Amazon rainforest with different ecosystems. What type of ecological unit is she in?
    6·3 answers
  • Which of the following characteristics is typical of the lytic cycle of a bacteriophage? A) Viral DNA is incorporated into the h
    14·1 answer
  • What results when a type a patient receives a transfusion of type b blood?
    7·1 answer
  • Which of the following is an advantage of biomass as an energy source?
    10·1 answer
  • Hello My name Is Chloe, Do you think you can help me with My Question
    11·2 answers
  • ( PLEASE HELP NEED A REAL ANSWER! )
    5·1 answer
  • Two plates moving towards each other are called convergent plates. Which
    6·1 answer
  • True/false: nerve tissue is found in the retina; the rods and cones in the back of the eye
    12·1 answer
  • HURRY please!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!