All categories

2 years ago

The measurement of the amount of water vapor in the air called

Biology

2 answers:

Marizza181 [45]2 years ago

5 0

The answer is humidity

Yuri [45]2 years ago

4 0

Humidity. I think you need to work on your grammar a little bit pal, if you ever need help with ELA homework, hmu.

You might be interested in

What is NOT a method used to

LiRa [457]

Answer:

making hole in the same to get the new DNA into the cell

5 0

1 year ago

Comparable segments of the mitochondrial DNA sequences of two similar species are shown below. This segment of DNA mutates at a

tangare [24]

99million years ago, so the answer is C

4 0

2 years ago

Read 2 more answers

Below is the double-stranded DNA sequence of part of a hypothetical yeast genome. Within this sequence is a small gene, PICO8, t

Serjik [45]

Answer:

D. There isn't enough information to determine which is the coding strand

Explanation:

In this protein, it would be necessary to observe a start codon (ATG) and one-stop codon (either TAA, TAG, or TGA) which should be separated by six (6) intern codons. It is not observable this nucleotide sequence in any of both DNA strands.

6 0

2 years ago

Some inbred strains of the weedy plant Arabidopsis thaliana flower early in the growing season, but other strains flower at late

RoseWind [281]

Answer:

a. Let us consider that L is responsible for late and l is responsible for early. From the mentioned data, it can be concluded that allele L or late is dominant over early. By crossing plants 1 and 4 we get the expected ratio of 3: 1, which shows that it follows Mendel's law of dominant.

b. The genotype of all the four plants are:

1st plant = Ll

2nd plant = ll

3rd plant = LL

4th plant = Ll

c. If the plant 1 is self-fertilized then the expected progeny will be 3 (late): 1 (early).

In case if the 2nd plant is self-fertilized, the expected progeny will be only early.

In case if the 3rd plant is self-fertilized, the expected progeny will be only late.

In case if the 4th plant is self-fertilized, the expected progeny will be 3 (late): 1 (early).

3 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago