1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mezya [45]
3 years ago
8

Compare and contrast the human and cat mouth and throat structures

Biology
2 answers:
blsea [12.9K]3 years ago
7 0
In regard to the human as well as the cat differences in regard to the structures in the mouth specifically the tongue, the human papillae have blunted,less numerous as well as softer while cat has many papillae, sharp and bristly filiform. For the teeth,cat have 3 incisors while humans have two.
matrenka [14]3 years ago
5 0

Answer: Human and Can have similar structure of the mouth and throat with little differences

Explanation:

The structure of the human mouth are the

1) Teeth: They tear and grind food taken in into small pieces that are suitable for digestion

2) Tongue: They are responsible for positioning and mixing of food and also carry sensory receptors for taste

3) Palete: They help to separates the mouth from the nasal cavity, allowing separate passages for air and for food.

WHILE

The structure of the cat's mouth consist of

1) The tongue: This is an elongated muscular organ covered on the surface withs PAPILLAE. These papillae contain tiny holes or pores that lead to taste buds. The bulk of the tongue consists of muscle bundles mixed with connective (strong/tough) and adipose (fat) tissue. It has many blood vessels and bleeds profusely when lacerated. The tongue is surrounded by the openings of the ducts of the salivary glands, which pour their secretions (saliva) into the oral cavity.

2) Teeth

Cats have two sets of teeth:

1) Deciduous teeth(may be called temporary teeth)

2)The adult teeth: They are larger than the deciduous teeth. Each teeth consists of four types of tissue which includes pulp, dentin, enamel and cementum.

Other structures of the cat's mouth includes upper and lower jaw, cheeks and glands.

You might be interested in
What is Cuiaba’s Biome?
saveliy_v [14]

Answer:

Deciduous Forest Biome

3 0
3 years ago
A piece of cartilage called the ___ closes over the top of the larynx during swallowing to direct food and liquids into the esop
maks197457 [2]
This structure is called the epiglottis. This flexible leaf-shaped cartilage serves as a flap that covers the larynx to prevent food and liquids from entering the airway and the lungs. It is open when we breathe which allows air to enter into the larynx.
6 0
3 years ago
Read 2 more answers
Please select the word from the list that best fits the definition The set of cultural characteristics that distinguishes one gr
Ierofanga [76]

Answer:

Ethnicity

Explanation:

<em>The correct answer would be </em><em>ethnicity</em><em>.</em>

<u>By definition, ethnicity refers to the variety of physical and behavioral characteristics that distinguishes one group of people from another group of people. </u>

Individuals or a group of people that shares the same culture and a sense of identity would belong to the same ethnic group while those with dissimilar culture and physical identity would be in different ethnic group.

4 0
3 years ago
Which word is most similar in meaning to data
schepotkina [342]

Answer:

Statistics would probably be the closest to data.

3 0
3 years ago
Read 2 more answers
What causes a land breeze at the beach?
Mnenie [13.5K]

Sea breeze and land breeze.

When sea is cooler than land, the wind blows the cool air up to the land, which on a beach has no structures to stop it, thus, it's cold.

Opposite works for land breeze.

8 0
3 years ago
Other questions:
  • If an object has 100 joules of potential energy at the top of a ramp. How much kinetic energy will there be at the other two pla
    9·2 answers
  • Which example is an abiotic factor of an aquarium environment?
    13·2 answers
  • How does the carbon atom complete its octet? A. It forms ionic bonds by sharing electrons. B. It forms covalent bonds by donatin
    11·1 answer
  • Which of the following is not true of cells?
    8·2 answers
  • Is the movement of water along the concentration gradient
    12·1 answer
  • Explain the difference between weathering and erosion
    6·1 answer
  • Dark skin (a result of increased melanin production in equatorial peoples) is likely a response to ultraviolet radiation, becaus
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • hey could someone help me with this immediately!! i’ll mark brainiest if u don’t guess or leave a link!
    5·2 answers
  • during what phase of a muscle twitch chemical changes such as the release of calicum are according intracelluary as rthe muscles
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!