1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
diamong [38]
3 years ago
10

A lake that is protected from receiving the runoff from a cultivated field is likely to remain a healthy ecosystem. Please selec

t the best answer from the choices provided T F
Biology
2 answers:
Gelneren [198K]3 years ago
8 0

Answer:

True

Explanation:

jonny [76]3 years ago
7 0
True, a lot of cultivated fields use fertilizers that can be harmful to fish
You might be interested in
Are mitochondria found in most plant cells? Explain.
Natasha_Volkova [10]

Yes because plant cell is eukaryotic and it is also in animal cell too.

5 0
3 years ago
The two basic types of cells found in neural tissue are
fredd [130]
1.) Neurons, they transmit nerve impulses<span>.
2.) </span>Neuroglial cells, non-conducting cells of the nervous tissue.
7 0
3 years ago
Disease or sickness is caused by microorganisms that grow rapidly between 41 and 140 degrees Fahrenheit. True or False
alisha [4.7K]

Answer:

It is True

Explanation

They thrive at temperatures  in the 41 to 140 degrees.

7 0
2 years ago
Which biome has the highest average temperature?
miskamm [114]

Answer:

Desert's as they have the hottest temperature if you don't count humidity.

Explanation:

The sun bears down on you and senses there is low amount of water you would dehydrate rapidly and soon die.

4 0
3 years ago
Read 2 more answers
Why are the light winged moths population changed?
Crazy boy [7]
They are changed because of the environments changing
7 0
3 years ago
Other questions:
  • Where does a peptide bond form?
    7·2 answers
  • What characteristic(s) might a human and a cat with extra sex chromosomes (XXY, share? ​
    9·1 answer
  • Why are all the Miller-Urey experiments essential to the theory of evolution?
    14·1 answer
  • How did avery help build our undertanding of genetics
    6·2 answers
  • Evaluate Models Cells are often compared to factories. How is a factory a useful model for explaining the cell?
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Glucose molecules can enter cells through the process of
    8·1 answer
  • Why do potato plants no longer need to use glucose from starch in respiration once they have grown above ground?
    13·1 answer
  • Norman grew skin in a lab by adding skin cells to a synthetic material. The skin functioned normally for 12 days. Then Norman se
    5·2 answers
  • What is the difference between telophase and cytokinesis?.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!