1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rufina [12.5K]
3 years ago
14

During the transmission of signals across a neuromuscular junction, which of the following happens first?

Biology
2 answers:
sergejj [24]3 years ago
6 0

Answer:

C. Synaptic vesicles release acetylcholine molecules.

Explanation:

A neuromuscular junction is the junction between the terminal part of a motor axon and a motor plate (or neuromuscular synapse), which is the region of the plasma membrane of a muscle fiber (the sarcolemma) where the nerve and muscle meet allowing to trigger muscle contraction.

At the neuromuscular junction, the neurotransmitter used is acetylcholine, which is released by the synaptic vesicles at the beginning of the signal transmission process through the neuromuscular junction. The nerve fiber branches off at the end to form the end plate. which invaginates into the muscle fiber, but rests entirely on the outside of the membrane.

Gre4nikov [31]3 years ago
4 0

Answer:

The correct answer is A acetylcholine binds to a receptor protein on the motor end plate

Explanation:

The neurotransmitter acetylcholine is released by the motor neuron during the transmission of signals across a neuromuscular junction.

         The released acetylcholine then diffuses the synaptic cleft and binds to the receptor protein present on the membrane of muscle fibre.

         This ultimately result in the influx of sodium ion inside the muscle cell thereby causing depolarization to generate an action potential.

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Granulocytes that contain granules of vasoactive amines such as histamines are called?
Gemiola [76]

Answer:

Basophils

Explanation:

#CareOnLearning

5 0
2 years ago
Which of the following examples best reflects selective breeding?
leonid [27]

Answer:

A The mating of two particular sheep to produce thicker wool

Explanation:

Selective breeding, also known as artificial selection, is the process in which people will choose two parent organisms to breed and create offspring with desired characteristics. In this case we want the sheep to breed and produce thicker wool.

6 0
3 years ago
There are some structures that are common to all prokaryotic cells, and others that are only found in some bacterial species or
puteri [66]

Answer: Nucleiod, Ribosomes, flagella, fimbriae, plasma membrane

Explanation: A typical bacteria cell possess these structures mentioned above. nucleiod is a chromosome , a nucleic acid which can be DNA or RNA, It is the genetic material of cell which every bacteria cell must have. Flagella ensures swimming movement of all bacterial cell. Ribosome of bacteria cells ensures protein synthesis. Since all bacteria cells meet, plasma membrane is permeability barrier, location of enzyme and transports solutes. Fimbriae enables bacterial cells attachment to surfaces

6 0
3 years ago
Based on the Resource Use and Conservation Virtual Lab, Which tactic can do the most to keep the water debt less than the water
Viefleur [7K]

Answer: D. Replacing thermal power plants.

Explanation:

Thermal Power Stations are some of the biggest users of water in the world because water is integral to producing electricity in them. These stations burn fossil fuels like coal which then vaporizes water so that it becomes steam which then drives turbines that produce electricity.

Water is also used for cooling high temperatures produced.

If these thermal stations are replaced with something that uses less water, it will go a long way in keeping the water debt less than the water supply.

7 0
3 years ago
Read 2 more answers
Other questions:
  • The nurse is assessing a client who has presented to the emergency department in emotional distress. what client data represents
    6·1 answer
  • How are rain and snow measured
    5·1 answer
  • PLEASE HELP ASAP!!!!!
    13·2 answers
  • Identify and define the four types of starch and liquid mixtures
    15·1 answer
  • Round seeds and yellow seed color are dominate to wrinkled seeds and green seed color. what is the probability of having offspri
    9·1 answer
  • Define what diffusion is
    12·2 answers
  • Malthus studied limited resources and the impact of limited resources on human populations. How did
    7·2 answers
  • If a lipid bilayer is at least 108 times less permeable to K ions than it is to water, how do the K ions that are needed for man
    11·1 answer
  • The role of the mitochondria is ?
    6·2 answers
  • Do you need to do math to become a Dentist?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!