Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
True
Explanation:
Transgenic animals are lines of animals produced by inserting copies of a specific gene or genes into a fertilized egg or early embryo.
The answer is c because the genes has all the genetic information inside of it.
Frogs reproduce by a special kind of embrace called "amplexus" which is an external fertilization that does not occur inside the female's body.
During mating (amplexus), the male frog grasps the female frog's trunk with his forelimbs.
The female frog discharges eggs into the water and then the male frog sheds the sperms over those eggs.
Answer:
The answer is E.) Lithosphere, Asthenosphere.
Explanation:
Tectonic plates belong to the layer called Lithosphere. The tectonic plates float on the Asthenosphere which is below the Lithosphere and more fluid than the crust.
From the Earth's surface to the its center we can say that the inside of the Earth is divided into four layers which, starting from the top , are:
i) the crust
ii) the mantle, (Lithosphere, Asthenosphere , Mesosphere)
iii) the outer core
iv) the inner core.
The tectonic plates are part of the Lithosphere and are constantly moving even though the crust is fairly solid. This is because the inner layers
( Asthenosphere , Mesosphere) are much are fluid and are constantly moving which tends to move the tectonic plates. When the tectonic plates collide they do so with tremendous force which leads to earthquakes and sometimes tsunamis as well resulting in a loss of life and property.
