1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
EleoNora [17]
3 years ago
7

The brain waves of sleeping infants appear to be qualitatively different from those of an adult who is dreaming.

Biology
1 answer:
Triss [41]3 years ago
7 0

The answer is no one knows the answer, however it is unlikely young infants do not have much to dream about, given -their relatively limited experiences. The brain waves of sleeping infants appear to be qualitatively different from those of adults who are dreaming.

You might be interested in
Do cold air masses and hot air masses automatically combine?
ankoles [38]

Answer:

If the boundary between the cold and warm air masses doesn't move, it is called a stationary front. The boundary where a cold air mass meets a cool air mass under a warm air mass is called an occluded front. At a front, the weather is usually unsettled and stormy, and precipitation is common."

Explanation:

5 0
3 years ago
Can I have any information on cells, anything at all, (facts or something)
Archy [21]
Cell- <span>the smallest structural and functional unit of an organism, typically microscopic and consisting of cytoplasm and a nucleus enclosed in a membrane. Microscopic organisms typically consist of a single cell, which is either eukaryotic or prokaryotic.</span>
8 0
3 years ago
Read 2 more answers
Kinetic energy is the energy of what?
ad-work [718]

Answer:

It’s the energy something holds while or due to the motion

Explanation:

6 0
3 years ago
Read 2 more answers
Our customers dogs have many different dietary needs, such as low-protein foods for kidney disease, and some of our customers si
Kruka [31]
In order to be sure you are always have enough of the right food in hand and get the best prices, in a situation in which customer dogs have many different dietary needs, and a lot of vendors on the other hand, you should use<span> a supply chain management system (SCM) to track vendor information, food usage trends, and food expiration. With SCM you will manage the flow of goods.</span>
4 0
3 years ago
Prostaglandins: A. stimulate smooth muscle contraction. B. have four-membered rings and are derived from arachidonic acid. C. ar
nevsk [136]

Answer:

The correct answer is option A, that is, stimulate smooth muscle contraction.

Explanation:

A group of lipids and a hormone that plays an essential role in monitoring the process of the formation of blood clots, stimulation of labor, the flow of blood and inflammation is known as prostaglandins. The hormone prostaglandin takes part in various kinds of body functions like the relaxation and contraction of the smooth muscles at the time of childbirth, monitoring blood pressure, dilation and constriction of blood vessels, and produce inflammation at the site of infection or tissue damage.  

Prostaglandins possess five-membered rings and are obtained from the fatty acid, arachidonic acid. At the time of blood vessel injury, thromboxane, that is, a form of prostaglandin enhances the process of blood clot formation so that the injury site gets heal quickly.  

4 0
3 years ago
Other questions:
  • The aurora borealis is caused by the ______.
    13·2 answers
  • The anticoagulant heparin is used for blood gases and other chemistry tests. it works by:
    10·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • There are two tomato plantlets. One of them is kept in an oxygen chamber with a light source and another is kept in sunlight. Bo
    11·2 answers
  • Flower color in snapdragons results from the amount of the pigment anthocyanin in the petals. Red flowers are produced by plants
    10·1 answer
  • Most life forms cannot use N2 as it exists in the atmosphere. ___________ are able to convert N2 to reactive nitrogen, which can
    5·1 answer
  • Which DNA base is referred to as a wild card due to its ability to change into one of the other bases?
    7·2 answers
  • Why is it a good idea to substitute transitions for visual elements in a text?
    5·2 answers
  • Fill in the blanks..​
    7·1 answer
  • What is globle warming
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!