1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neko [114]
3 years ago
5

What is the general term for any carbohydrate monomer?

Biology
1 answer:
Liono4ka [1.6K]3 years ago
8 0

Answer: by being smart and pog and swag

Explanation:

You might be interested in
Where do plants typically store their starches and sugars for later use?
yaroslaw [1]

Answer: In the roots

The leaves of a plant make sugar during the process of photosynthesis. To make sugar,  the plant uses chlorophyll, energy from sunlight, carbon dioxide from the atmosphere and water. Some of the glucose (sugar) is changed to starch which they typically store in the roots for later use.

4 0
4 years ago
Read 2 more answers
What does observations mean
melisa1 [442]

Answer:

Basically, observation can be defined as the action or process of observing something or someone carefully or in order to gain information, in other words, watching or analyzing something so as to know more about it. For example, if a biologist wants to observe the behaviour of a specific kind of animal in the wild, that person  will have to watch and focus on what that animal usually do, what it usually eats, how it hunts or find food, etc, in order to know more about the animal itself.

4 0
3 years ago
Read 2 more answers
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
How does the circulatory system work
max2010maxim [7]

Answer:

The circulatory system is made up of your veins. They carry blood to your heart and away from it. The blood going through your body carries oxygen, nutrients, and hormones, and removes wastes like carbon dioxide.

Explanation:

7 0
3 years ago
Read 2 more answers
What is the main function of a vacuole in a cell
harkovskaia [24]
They can be used to contain cellular waste and to isolate materials that may be harmful to the cell.
8 0
4 years ago
Other questions:
  • 5. Change the friction to the maximum amount.
    15·1 answer
  • In Liepmann's theory of left-hand apraxia, the MOST likely location of the lesion would be:
    5·1 answer
  • What do zebra mussels eat?
    11·2 answers
  • What factors are important for the development of intelligence? Select all that apply.
    12·1 answer
  • Nuclear envelope forms at each pole spindle dissolves chromosomes uncoil These processes occur during A) anaphase. B) metaphase.
    6·2 answers
  • In commensalism, one species benefits and the other neither benefits nor is harmed.
    9·2 answers
  • Describe the two main phases of the cell cycle
    6·1 answer
  • Is space a limiting factor for plant population name 3 ways
    6·1 answer
  • The feature on the ocean floor at is call a(n)
    9·2 answers
  • Based on how seawater density works, what type of water would you expect to find on the ocean's surface?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!