All categories

3 years ago

Which type of society is most likely to have a great number of factories?

Biology

1 answer:

Sergio039 [100]3 years ago

7 0

Answer:

Explanation:

Hunting and gathering tribes, industrialized Japan, Americans—each is a society. But what does this mean? Exactly what is a society? In sociological terms, society refers to a group of people who live in a definable community and share the same culture. On a broader scale, society consists of the people and institutions around us, our shared beliefs, and our cultural ideas. Typically, more-advanced societies also share a political authority.

You might be interested in

The “brain” of the cell is located in the

mariarad [96]

The Nucleus is sort of like the "brain" of a cell.

4 0

3 years ago

Read 2 more answers

The ______ rocks in the seafloor are much ______ than the ______ rocks on the continents.

Kruka [31]

Answer:

I think this is it,

Explanation:

The rocks in the seafloor are much more than the rocks on the continents

FunkyMagmaYT

3 0

2 years ago

Photosynthesis transforms blank into chemical energy by blank sugars. Cellular respiration releases the blank from food by blank

creativ13 [48]

Photosynthesis and Cellular respiration, both cellular processes are important for life, however, we need to understand what happens to confirm this information....

<h3>Photosynthesis</h3>

Most life on Earth depends on photosynthesis. The process is carried out by plants, algae, and some types of bacteria, which capture energy from sunlight to produce oxygen (O2) and chemical energy stored in glucose (a sugar). Herbivores then obtain this energy by eating plants, and carnivores obtain it by eating herbivores.

Inside the plant cell are small organelles called chloroplasts, which store the energy of sunlight. Within the thylakoid membranes of the chloroplast is a light-absorbing pigment called chlorophyll, which is responsible for giving the plant its green color. During photosynthesis, chlorophyll absorbs energy from blue- and red-light waves, and reflects green-light waves, making the plant appear green.

<h3>Cellular respiration</h3>

Cellular respiration, the process by which organisms combine oxygen with foodstuff molecules, diverting the chemical energy in these substances into life-sustaining activities and discarding, as waste products, carbon dioxide and water.

One objective of the degradation of foodstuffs is to convert the energy contained in chemical bonds into the energy-rich compound adenosine triphosphate (ATP), which captures the chemical energy obtained from the breakdown of food molecules and releases it to fuel other cellular processes.

With this information, we can say that photosynthesis transforms solar energy into chemical energy through sugars. Cellular respiration releases energy from food through sugars.

learn more about photosynthesis brainly.com/question/1388366?referrer=searchResults

5 0

2 years ago

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0

3 years ago

DNA replication occurs during which phase of the eukar yotic cell cycle?

Ann [662]

its either The division cycle of most eukaryotic cells is divided into four discrete phases: M, G1, S, and G2. M phase (mitosis) is usually followed by cytokinesis. S phase is the period during which DNA replication occurs or In eukaryotes, the cell cycle consists of four discrete phases: G1, S, G2, and M. The S or synthesis phase is when DNA replication occurs, and the M or mitosis phase is when the cell actually divides. The other two phases — G1 and G2, the so-called gap phases — are less dramatic but equally important. hope this helped!!

3 0

2 years ago