1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serjik [45]
3 years ago
8

Women earn less than men,on average,because

Biology
1 answer:
larisa86 [58]3 years ago
7 0

Answer:

women on average, earn less than men because men are more likely to hold managerial, administrative, or executive jobs, while women are more likely than men to become stay at home parents, or work in jobs with fewer hours so that they are better able to care for children.

You might be interested in
The life forms exhibiting the simplest cellular structure are?
const2013 [10]
 Prokaryotes are the Earth`s firs living things. This are the simplest life forms exhibiting ( showing ) cellular structures.
  They exist in 2 major forms:
   - Eubacteria  ( most of the common bacteria that are found everywhere ),
   - Archaebacteria ( ancient bacteria that live in very extreme conditions ).
   Answer:  Prokaryotes.
3 0
3 years ago
Which of the following are disadvantages of mono-culture cropping?
professor190 [17]
The answers is all of the above
7 0
3 years ago
Which statement is supported by the cladogram?
fgiga [73]

A cladogram is a diagram used to represent a hypothetical relationship between groups of animals, called a phylogeny.

In this set of examples the answer is:

D) The lamprey does not have a vertical column

Lampreys have a notochord that remains throughout life, but they have primitive vertebrae made of cartilage. Lampreys have vertebral arches, but nothing resembling the vertebral bodies found in all higher vertebrates. Even the arches are discontinuous, consisting of separate pieces of arch-shaped cartilage around the spinal cord in most parts of the body, changing to long strips of cartilage above and below in the tail region.

7 0
3 years ago
During periods of intense exercise, cells do not receive enough oxygen to perform the normal process of aerobic cellular respira
Wewaii [24]

Answer: for me the best option is D.

Explanation: lets explain this.

Cellular respiration begins with a process that divides the glucose within the cells making it readily available as a source of energy. This process can occur without oxygen (anaerobic respiration) or in the presence of oxygen (aerobic respiration). Anaerobic respiration generates more excess waste (lactate) than aerobic . Besides, high levels of lactate build within the muscle cells. Excess lactate slows the cellular respiratory process and is experienced as a burning sensation in the muscles if exercise continues.

5 0
3 years ago
In Figure 8–4, why might the candle in jar A burn longer than the candle in jar B?
castortr0y [4]
Need a picture!!
so send me one then I'll answer your question!!!!
5 0
3 years ago
Other questions:
  • A protein has altered funtion as a result of a single amino acid substition in the polypeptide (protein). this change resulted f
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Explain how antibiotic resistance in bacteria provides evidence that supports Darwin’s theory of evolution
    7·2 answers
  • explain why there are no giant cells. Use the terms diffusion, cell membrane and cell volume in your answer.
    13·1 answer
  • Piyush is asked to classify samples of bacteria as bacilli, cocci, or spirilla.
    5·1 answer
  • Fossils are the ____? ( 1 point )
    15·1 answer
  • How is this marked wrong wouldnt it be 18 cm ?
    12·1 answer
  • 3) What is the density of a rock with a volume of 4 cm3 (cubed) and a mass of 12 grams?
    11·2 answers
  • If you forget to add the decolorizing agent when performing a Gram stain, what color will the gram-negative cells be
    6·1 answer
  • Caicium Absorption A variety of factors can inhibit or enhance calcium absorption. Indicate whether each situation increases or
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!