1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fynjy0 [20]
3 years ago
6

Nutrients which an animal can synthesize for growth and maintenance are in a category called

Biology
2 answers:
LUCKY_DIMON [66]3 years ago
7 0
Nutrients which an animal can synthesize for growth and maintenance are in a category called non-essential nutrients. Essential nutrients are nutrients that are body cannot make or produce in sufficient quantities; they are therefore obtained through the diet.They include the building blocks of carbohydrates, lipids and proteins, certain vitamins, minerals, and water. Non essential nutrients on the other hand are those that can be made by the body. 
MatroZZZ [7]3 years ago
4 0

Nutrients which an animal can synthesize for growth and maintenance are in a category called non-essential nutrients. Non-essential nutrients have a notable effect on health and they can be synthesized by the body or acquired from sources other than foods. Non-essential nutrients include amino acids (alanine, asparagine, aspartic acid), Vitamins (Biotin, vitamin K and D) and dietary fiber and cholesterol.






You might be interested in
Help!!! The question is in the picture.
Natali [406]

Answer:

18 is the nuclesus, 20 is the smooth endoplasmic reticulum and 21 is the golgi apparatus and 19 is the microtubes and 17 is the vacules.

Explanation:

5 0
2 years ago
Answer asap!!!!!!~ If traveling to a country where malaria is widespread, what precaution should you take to avoid the disease?
Fiesta28 [93]

Answer:

C

Explanation:

because antivirals are drugs and antibiotics cab o nothing to viruses it is not even effective for the common cold So mosquito repellent would be the best choice

7 0
3 years ago
Which of these tasks would a hydrologist be most likely to perform?
GuDViN [60]

Hydrologists are most likely to perform actions relating to estimating the amount of groundwater in an aquifer.

<h3>Hydrologists</h3>

Hydrologists are scientists that specialize in the study of how water relates to the various crusts of the earth.

Hydrology in itself refers to the branch of science that studies how water moves relative to the earth's crusts.

Thus, species identification, age of fossils, or extracting underground oils have nothing to do with the work of hydrologists.

More on hydrology can be found here: brainly.com/question/13554728

5 0
2 years ago
A 47 year-old male presents with chronic back pain and lower left leg radiculitis. A laminectomy is performed on the inferior en
Morgarella [4.7K]

The correct codes are 63267 and 69990.

The codes are given based on the lesion if it is intradural or extradural. In our case here it is extradural cystic structure so that is why it ranges between 63265 to 63268.

We also divide the section of spine depending on where the lesion is being located. Code 63267 describes laminectomy which has evacuation of intraspinal lesion which is found in the lumbar spine.

69990 code documents the use of microscope.

7 0
3 years ago
Which of the following sequences of processes correctly reflects the central dogma?
Lapatulllka [165]
Transcription, Translation, protein synthesis
4 0
3 years ago
Other questions:
  • HELP?! _______ are the simplest creatures that possess an anus. A. Flatworms B. Roundworms C. Jellyfish D. Sea anemones
    15·1 answer
  • How the carbon cycle and nitrogen cycle contribute to the use of organic compounds
    8·1 answer
  • Which would likely live near a crack in the deep ocean floor that spews scalding water? A. halophile B. methanogen C. thermoacid
    14·2 answers
  • In a paragraph, summarize how immunizations can prevent certain diseases. (Site 1)
    9·1 answer
  • Angie hit the back of her head and now she has difficulty walking. her doctor found that her spinal cord is intact but her _____
    12·1 answer
  • what other substance besides carbon dioxide and water is released in the form of energy during cell respiration during the cell
    12·1 answer
  • Somatic cancer cells often are unstable and divide inappropriately (divide when they should not be dividing). In addition such c
    10·2 answers
  • What is the correct process of hearing??
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Select the correct compound.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!