1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
What mineral is mined in the Congo and used in cell phones?
kkurt [141]
Tantalum.................
3 0
4 years ago
Convert 59.48 g to kilograms
tamaranim1 [39]
I got 0.05948 hope this helps and sorry I'm not good at explaining hopefully someone else can explain
5 0
3 years ago
Read 2 more answers
Magma that squeezes into a horizontal crack is called a _____. Magma that squeezes into a vertical crack is called a _____.
melamori03 [73]
Magma that squeezes into a horizontal crack is called a Sill. Magma that squeezes into a vertical crack is called a Dike.
7 0
4 years ago
Read 2 more answers
Temperate deciduous trees lose their leaves in Fall. Explain why trees in temperate rainforest and tropical rainforest don’t los
oksano4ka [1.4K]

Answer: Many are DECIDUOUS TREES that lose their leaves in fall, but the broad-leaved trees of a tropical rain forest are evergreen. The mass of leaves of adjacent trees form a CANOPY.

Explanation: I hope this helps, I am stuck on the same question too.

7 0
3 years ago
Which is most responsible for the decay of dead organisms?
motikmotik

insects and buzzards/vultures.

7 0
4 years ago
Read 2 more answers
Other questions:
  • Which country imports the most metals? A.Africa B.Japan C.Australia D.Russia
    5·2 answers
  • Why would scientist want to store dna for a long period of time?
    11·1 answer
  • Illustrate passive transport.<br> Pls HELP
    6·1 answer
  • Which part of the body does the pelvis protect?
    10·2 answers
  • Two capacitors of 1μF and 2μF are connected in series across a 100V supply. The energy stored in the system is ?
    11·1 answer
  • The table below shows the number of chromosome pairs for various
    10·1 answer
  • Question 5
    12·1 answer
  • suppose two parents, a father with the genotype aabbccddee and a mother with the genotype aabbccddee, want to have children. ass
    13·1 answer
  • How did the ecology of the african tropics change about 6 million years ago?.
    8·1 answer
  • Most bacteria are ______, feeding on organic material formed by other organisms.
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!