1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
Which will most likely cause an increase in the frequency of genetic mutations in
Aleksandr [31]

Answer:

Increased exposure to X-rays

Explanation:

X-rays shoot harmful radiation through your body, that's why when you go to the dentist or other places and they take a X-ray they give you a lead vest to protect your organs from unneeded radiation.

hope this helps :)  

8 0
3 years ago
Animals that have a complete<br>tube-like gut with two openings​
AfilCa [17]

Answer:

All mammals, like dogs, cats, and humans; reptiles, amphibians, fish, birds, and even insects.

Explanation:

All mammals, like dogs, cats, and humans; reptiles, amphibians, fish, birds, and even insects are the animals that have a complete  tube-like gut with two openings​. A system having a tube with two openings i.e. mouth and an anus is called tubular system. In this tubular system, the animals eat with one opening and the other opening is used for excretion of waste and nitrogenous materials from the body so that's why most of the animals have two openings.

7 0
3 years ago
Answer the question please
MrRissso [65]

Answer: the answer is D

Explanation:

8 0
3 years ago
Read 2 more answers
Which word identifies the agent that carries the energy released from earthquakes?
Mnenie [13.5K]

The correct answer is seismic waves.  

A sudden movement of the Earth's crust followed by the production of seismic waves is known as an earthquake. The seismic waves travel outwards from the source. The sudden vibration or ground motion is generated due to a brisk discharge of accumulated energy.  

The vibrations, which travel via Earth carrying the energy discharged at the time of an earthquake is known as seismic waves. The earthquakes are usually determined with a help of seismometer, called seismograph.  


4 0
3 years ago
Read 2 more answers
You tear a piece of paper in half to make it smaller. What type of property
andrey2020 [161]

Answer:

D. A physical property

8 0
3 years ago
Read 2 more answers
Other questions:
  • A biologist measures the allele frequencies of pea plants in a very controlled environment. The plants can either have a dominan
    13·2 answers
  • How do scientist predict the patterns of heredity?
    6·1 answer
  • Select all that apply.
    10·2 answers
  • 1 2 3 4 5 6 7 8 9 10
    11·1 answer
  • A snail, elodea (aquatic plant), or both were added to the tubes and they were stoppered. Tubes were placed under a grow light f
    7·1 answer
  • What are benefits of using tissue cultures to study medications used for treating cancer cells
    9·1 answer
  • Will give Brainly plz help
    12·2 answers
  • An animal science career in the marketing merchandising and sales representatives category is: Group of answer choices Livestock
    13·1 answer
  • Which sport below requires the least cardiovascular fitness?
    10·1 answer
  • What is a possible pH of acid rain?<br> 07.0<br> 6.9<br> 04.3<br> 10.5
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!