2 years ago

1. Replicate the following DNA segment 5’

Biology

1 answer:

Wittaler [7]2 years ago

4 0

The answer is

tcgccctactcgcgtacaccgcgtattgac3’ 3’

agcgggatgagcgcatgtggcgcataactg5’

This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine). Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil

You might be interested in

A food service employee with an open cut or wound may be permitted to prepare food if the:

Alex

Man wears gloves and has protective clothing

5 0

2 years ago

Read 2 more answers

People who get angry easily tend to have more heart disease. that's the conclusion of a study that followed a random sample of 1

statuscvo [17]

Sorry I could not figure it out.

6 0

2 years ago

Consider the shape and structure of the virus in the diagram. Which viral shape is shown?

enot [183]

The choice is C i just took that quiz

I hope this helps!!!

8 0

2 years ago

Read 2 more answers

In an ecosystem with similar species, we typically find

pishuonlain [190]

A bunch of the same critters. Nah I am just kidding, you will find a lack of resources because if they are all the same animals they will all eat the same thing. I hope this helps you.

8 0

2 years ago

What happens if you connect a battery to a small light bulb with a single wire .?

Verdich [7]

The light will not light up,
; the circuit is incomplete

Also I consider this physics and electronics

6 0

2 years ago