1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
2 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]2 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
When warm air contains all the water vapor it can hold and then the air cools down, the water vapor becomes liquid water or ice
igomit [66]

Answer:

Condensation

Explanation:

6 0
3 years ago
Read 2 more answers
Answer the following questions.
Dafna1 [17]

Answer: reading paper books and magazines,  sleeping in beds under cotton sheets, having a sandwich for lunch , sitting at wooden desks , I picking wildflowers , eating a favorite breakfast cereal.

Explanation: These are all correct because each has to deal with plants. For example, reading the paper books, sleeping in the bed and sitting at the wooden desk all have to due with the products that come from plants. Paper, cotton, and wood are all grown from plants and turned into resources. Next picking flowers, eating foods are also direct examples of how plants help us. Picking flowers that come directly from plants. Then eating food that is grown from plants shows that it is directly plants providing for humans.

6 0
2 years ago
What can we infer from the stickleback fossil record about evolutionary processes occurring today?
s2008m [1.1K]
<h3><u>Answer;</u></h3>

Evolutionary patterns observed in the fossil record are consistent with evolutionary processes occurring today.

<h3><u>Explanation;</u></h3>
  • Three spine stickleback is a model organisms for studies in evolution because; Stickleback fish are small and have short generation times. These two characteristics make them easy to keep in a lab and useful for conducting genetic studies, since researchers can follow several generations of fish in a relatively short time.
  • Also, stickleback fish populations occur throughout the Northern Hemisphere in a wide range of environments, so researchers can compare different populations and study how they have changed over time in response to different environmental pressures.
3 0
2 years ago
The protein separates from the ribosome in which step of translation?
zavuch27 [327]
<span>Translation involves taking the message that's in the messenger RNA and in a sense decoding the message from the language of nucleic acids to the language of proteins or polypeptides. it includes 3 distinct steps which are initialization, elongation and termination.</span>
8 0
3 years ago
Metamorphic rock can form from
Levart [38]

Answer:

Metamorphic rocks form from heat and pressure changing the original or parent rock into a completely new rock. The parent rock can be either sedimentary, igneous, or even another metamorphic rock.

6 0
3 years ago
Other questions:
  • WILL GIVE A BRAINLEST
    14·1 answer
  • Why is the action of phagocytes considered a nonspecific response?
    8·2 answers
  • Which sedimentary rock has the coarsest grain?
    8·1 answer
  • How can you best identity quackery in a health service provider
    9·1 answer
  • What are potential mechanisms that can lead to endocrine dysfunctions?
    10·1 answer
  • Biologists identify four major components in an ecosystem: producers, consumers, decomposers, and the abiotic environment. what
    11·1 answer
  • Fats are absorbed by the epithelial cells of villi in the intestinal tract and enter the capillary beds of the circulatory syste
    6·1 answer
  • PLEASE HELP ASAP<br> What are the three stop codons? What is the start codon?
    6·1 answer
  • What would best describe the structure of the plasma membrane?
    7·2 answers
  • A man who heavily smokes has developed lung cancer. The tobacco smoke has caused mutations in some of the cells in his lungs, ma
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!