1. Replicate the following DNA segment 5’

Biology

1 answer:

Wittaler [7]2 years ago

4 0

The answer is

tcgccctactcgcgtacaccgcgtattgac3’ 3’

agcgggatgagcgcatgtggcgcataactg5’

This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine). Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil

You might be interested in

1. How is the nervous system similar to other body systems? How is it different?

Degger [83]

Answer:

it is similar because it involves multiple body parts.

it is different because it doesn't involve breaking down anything or providing things through the blood.

hope i helped...............mark me brainliest?

4 0

2 years ago

All four types of amino acids

stealth61 [152]

Answer:Non-Polar and Neutral, Polar and Neutral, Polar and Acidic, Polar and Basic