1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
Where does a peptide bond form?
Paul [167]
A Peptide bond is formed between two molecules 
Example: when Carboxyl group and amino group form its releasing a water molecule. (H2O) well i hope this help i did my research c: 
3 0
3 years ago
Read 2 more answers
Where do cold fronts form and what type of weather is formed?
Fiesta28 [93]

Answer:

Cold fronts form when a cooler air mass moves into an area of warmer air in the wake of a developing extratropical cyclone. The warmer air interacts with the cooler air mass along the boundary, and usually produces precipitation

3 0
3 years ago
What is happening at point a?
faltersainse [42]

the population size is at 300 and yeah

3 0
3 years ago
Read 2 more answers
What kinds of action could a government take during a pandemic?
Cloud [144]

Answer:

During any pandemic, government can make people aware about that pandemic and can provide the necessary things like shelter, food etc. to poor people. Government can also help people by money.

4 0
3 years ago
You are a molecule of water. Choose a starting
olya-2409 [2.1K]

Answer:

In water cycle, water evaporates from the sea and oceans in the form of water vapors due to the radiation of the sun. This evaporation in the ocean is the starting point of water cycle.

Explanation:

Water cycle is also called hydrological cycle. In this cycle , water evaporates from water bodies such as rivers, seas, ponds and oceans etc. Water is also evaporated from plant bodies in the process of both evaporation and transpiration. This water moves in the form of vapors and forms clouds. These clouds moves to the land and fall on the earth surface in the form of rainfall and snowfall. From there, this water moves to the oceans through lakes and rivers and repeat the cycle again.

5 0
4 years ago
Other questions:
  • During which type of cell division does each daughter cell contain half the amount of dna as did the cell just prior to cell div
    9·1 answer
  • Solagans on the donation of kidney
    8·2 answers
  • Explain the conversation of mass during cellular respiration
    12·1 answer
  • Scientist who studies the plant life in an environment
    14·2 answers
  • Why is there more than one single locus probe used in actual paternity DNA test?
    15·1 answer
  • Gasses that contribute to the greenhouse effect
    12·1 answer
  • What did frederick griffith want to learn about bacteria?
    7·1 answer
  • ¿que contamina mas?
    15·1 answer
  • True or False- The thermosphere contains no water vapor.
    15·1 answer
  • Put the steps of mitosis in the correct order
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!