1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
2 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]2 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
Explain how some substances cross the cell membrane by facilitated diffusion?
Westkost [7]
The substance is guided through a protein embedded in the membrane from high to low concentration since this not considered as active.
6 0
3 years ago
Which of the following is not a source of genetic variation?
Mashcka [7]
<span>the one that is not a source of genetic variation is : D. Asexual reproduction In asexual reproduction, there is no fertilization process between male and female gender. Which mean the offspring that came from asexual reproduction would be exactly the same as its parent, without any chance of genetic variation</span>
5 0
3 years ago
Read 2 more answers
Why must sexually reproducing organisms produce sex cells that have half the genetic information (DNA) as they have in all their
weqwewe [10]

Answer:

Because offspring with two parents will share half of each parent's DNA.

Explanation:

Sex cells contain half of the genetic information of an organism's regular cells. This is because a sexually-produced organism will be unique; it will share genetic information with both of its parents, rather than be identical to its bearer (like an asexual organism would be). When a sex cell meets another sex cell, their DNA will meet as well and change/adapt to suit the organism. If a sex cell had all the information needed to create an embyro, instead of half, which requires another cell's information to fill the DNA void.... well, it would just do it.  

5 0
2 years ago
A segment of DNA that contains information to make a protein is called a "
N76 [4]
The answer is a “gene”


A gene is a functional segment of DNA that provides the genetic information necessary to build a protein. Each particular gene provides the code necessary to construct a particular protein.

hope this helps !
5 0
2 years ago
Read 2 more answers
Which of the following activities can be directly linked to desertification? (1 point)
Serggg [28]

Answer:

I and II

Explanation:

I. irrigation of cropland   &   II. harvest of biomass for energy

7 0
3 years ago
Read 2 more answers
Other questions:
  • Condition in which physical symptoms appear as a defense against overwhelming anxiety:
    12·1 answer
  • Explain what the line plot on a climate diagram shows
    13·1 answer
  • Disease transmission through contaminated food can be reduced by proper cooking techniques and regulations. Please select the be
    8·2 answers
  • Select the most appropriate statement with respect to cellular respiration in humans.
    9·1 answer
  • How is an apex consumer different from a primary consumer? Give an example.
    13·1 answer
  • Answers for 10 and 11
    12·1 answer
  • An organism has a nucleus and is multicellular but has no cell wall and no chloroplasts
    13·2 answers
  • What are the functions of cell sap?
    12·1 answer
  • Determine if the limiting factors listed below are density-dependent or density-independent.
    8·1 answer
  • Humans convert ammonia to the water soluble compound urea. True O False​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!