1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
If a plant is composed of cells that contain nuclei are they eukaryotic prokaryotic or multikaryotic?
gavmur [86]

Answer:

The predominantly single-celled organisms of the domains Bacteria and Archaea are classified as prokaryotes (pro– = before; –karyon– = nucleus). Animal cells, plant cells, fungi, and protists are eukaryotes (eu– = true).

Explanation:

3 0
3 years ago
Read 2 more answers
Plz help me with this asap
Virty [35]

Answer:

Definitely option C

Explanation:

hope it helps

6 0
3 years ago
What defines a symbiotic relationship?
rjkz [21]

Answer:

Symbiosis is a close relationship between two species in which at least one species benefits. For the other species, the relationship may be positive, negative, or neutral. There are three basic types of symbiosis: mutualism, commensalism, and parasitism! Hope this helps! you can simplify this answer!

Explanation:

8 0
3 years ago
predict how earth’s geological features, such as mountains, will change in the future based on tectonic plate movement.
marysya [2.9K]
Explain how the reactions of “the bloodless ghouls” to Orpheus’s song in paragraph 3 are important to the overall theme of the story. Cite evidence from the story in your response.
7 0
4 years ago
HELP!!! ASAP!!!! If immigration and emigration number remain equal, which of these could cause a slowed growth rate?
mixas84 [53]
<span>Decreased birthrate, thus c: is your Answer</span>
6 0
3 years ago
Other questions:
  • What are the two main reasons why cells divide rather than continuing to grow?
    11·1 answer
  • Match each statement below to the correct scientist.
    13·1 answer
  • In January the earth is tilted towards the sun yet the northern hemisphere is in winter explain why
    11·1 answer
  • PLZ HELP ASAP. I DONT UNDERSTAND THIS
    11·1 answer
  • Decide whether the drawings, shown below, are acceptable Lewis diagrams for the species indicated.
    9·2 answers
  • DNA is replicated with a leading and ____ strain, this strand is DNA in the opposite side of the replication fork.
    7·2 answers
  • Over the past century, several scientists around the world have made the following observations:
    9·1 answer
  • How does the endocrine system control body processes? WORTH 20 POINTS
    12·1 answer
  • Why is crossing over of the chromosomes during meiosis important? (multiple choice)
    9·1 answer
  • Difference between palisade cell and fungal cell
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!