1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
What are the functions of the products of photosynthesis in living things?
HACTEHA [7]

Oxygen - It is very important for all living to survive 'cause without it, cellular respiration can't take place....

Glucose - It is the simple food, it provides energy to the whole ecosystem, so that they can survive. 

Without either of them, life is not possible!!!!!

5 0
4 years ago
Ancient Earth:
IgorLugansk [536]

Answer:

b. the atmosphere

Explanation:

5 0
3 years ago
The first line of medical care in great britain is the:
Degger [83]
Healthcare should be the answer.
4 0
3 years ago
Four gases are described below:
kow [346]

Gases A, B, and D all have the same average molecular kinetic energy, since they are at 12°C.

Explanation:

5 0
3 years ago
Read 2 more answers
Which phrases describe groundwater? Check all that apply.
elena-14-01-66 [18.8K]

Groundwater refers to the water present underground, in the spaces and cracks in the sand, soil, and rock. It is accumulated in and moves gradually through the geologic creations of sand, soil, and rocks known as aquifers.  

The groundwater supplies drinking water to about 51 percent of the total population of the United States and 99 percent of the rural population. Almost 64 percent of the groundwater is utilized for irrigation purposes, and it is also a source of recharge for rivers, lakes, and wetlands.  

Hence, the correct phrases that describe groundwater are feeds rivers, used for irrigation, and provides drinking water.  


5 0
3 years ago
Read 2 more answers
Other questions:
  • What does low white blood cell count and low neutrophils mean?
    9·1 answer
  • EXPLAIN the difference between qualitative and quantitative data. Give examples to support your responses.
    7·2 answers
  • To be considered a source of water pollution, the source must include a chemical
    6·2 answers
  • Which of the following is NOT a function of the digestive system?
    13·2 answers
  • Is the process of bringing nutrients into the bloodstream while<br> is getting rid of waste *
    11·2 answers
  • PLZ HURRY IT'S URGENT!!!
    13·1 answer
  • Different between breathing and cellular respiration I
    11·1 answer
  • Please help! I will give brainliest!! Summarize the steps of transcription. (picture above)
    5·1 answer
  • Jill wants to conduct an investigation to determine what happens to the temperature of water if it is left in the sun. She place
    5·1 answer
  • During a venipuncture, if the area surrounding the vein begins to swell, creating a hematoma, you should first:______
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!