1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
You are given an earthworm and you are asked to study the internal structure of the earthworm. Which one of the following will y
timama [110]

Answer:

C

Explanation:

5 0
4 years ago
If your temporal lobe was damaged, what might happen to you?
nikklg [1K]

Answer:

c you would have trouble remembering things.

Explanation:

Difficulty learning and retaining new information. Impaired factual and long-term memory, Persistent talking, Difficulty in recognizing faces.

7 0
3 years ago
Molecules in food contain chemical energy that cells use to produce____
icang [17]
Molecules in food contains chemical energy that cells use to produce MORE CELLS. This energy is gotten from the chemical bond energy in food molecules, which in this way serve as fuel for cells. The particles in food additionally give the atoms that animals need to develop new living matter.
3 0
3 years ago
Which of these microbes has the most complex cell wall?
vivado [14]
Plant cells have what is perhaps the most complex outer coverings. Plant cell walls are made largely of cellulose which forms strong, highly rigid, almost indigestible coverings that protect the cell and gives it shape.
4 0
2 years ago
Drinking non-potable water does not carry significant health risks
lesya [120]
Non potable waters are not for drinking. It is not safe to be drink that's why drinking it can carry significant health risk on our body. Non potable waters are only for irrigation and other non drinking water activity. POtable waters are the water that is clean and safe to drink

5 0
3 years ago
Read 2 more answers
Other questions:
  • "Most populations demonstrate _____ growth, in which the population size increases exponentially until it levels off near the ca
    5·1 answer
  • HELP!<br> What is the purpose of orbital fat around the eyeball? TWO possible purposes, please!
    14·1 answer
  • The darwinian theory of organic evolution through natural selection affected american religion in what ways?
    12·1 answer
  • How many planets are there in the solar system?
    15·2 answers
  • HELP PLSLSLSLSLSLLSSL
    5·1 answer
  • The simplest animals that are bilaterally symmetrical and triploblastic (composed of three fundamental layers) are the Platyhelm
    14·1 answer
  • BEST example of the sustainable use of a natural resource
    15·1 answer
  • Which of the following is an indicator that energy has been transferred? Select all that apply.
    12·1 answer
  • Tay-Sachs is an inherited, recessive trait which involves the inability to properly break down certain lipids. A normal couple h
    9·1 answer
  • What form of heat transfer can travel through a vacuum.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!