1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
Which of these statements about light microscopes and electron microscopes is NOT true?
Varvara68 [4.7K]
I believe your answer is B, Because electrons are clinched to protons, most times, therefor there is not an electron microscope, but a ELECTRONIC Microscope will show the organism on a screen. hope that helped some<span />
8 0
3 years ago
Which suspect’s DNA matches that found at the crime scene? Does this automatically mean that the suspect is guilty? 2. What poss
igomit [66]

Answer:

RFLP analysis of genomic DNA is facilitated by Southern blot analysis.   After electro-phoresis, DNA fragments in the gel are denatured by soaking in an alkali solution.  This causes double-stranded fragments to be converted into single-stranded form (no longer base-paired in a double helix).  A replica of the electrophoretic pattern of DNA fragments in the gel is made by transferring (blotting) them to a sheet of nitrocellulose or nylon membrane. This is done by placing the membrane on the gel after electro-phoresis and transferring DNA fragments to the membrane by capillary action or electro-transfer.  DNA, which is not visible, becomes permanently adsorbed to the membrane, that can then be manipulated easier than gels.

Explanation:

4 0
3 years ago
What is the term for the symbiotic association between fungi and cyanobacteria?
SSSSS [86.1K]

Answer:

lichen

Explanation:

Lichens are symbiotic associations of mutualism between fungi and algae. Most lichen-forming fungi are ascomycetes (98%), the remainder being basidiomycetes. The algae involved in this association are chlorophytes and cyanobacteria. The fungi of this association are called mycobionte and the algae, photobionte, since it is the photosynthetic organism of the association.

The dual nature of lichen is easily demonstrated by the separate cultivation of its components. In the association, the fungi take different forms from those they had when isolated, most of the body of the lichen is formed by the fungus.

5 0
3 years ago
Read 2 more answers
Match the words below to the appropriate blanks in the following sentences.
Masteriza [31]

Answer:

1. Malonyl CoA

2. Inhibits

3.fatty acil CoA

4. Carboxylase

5. Insulin

6. Synthesis

7. Glucagon

8. Oxidation

Explanation:

the oxidation of the mitochondria is blocked by the entry of fatty acid units, a reaction produced by stopping the carnitine acetyl transferase mediated by Malonyl CoA

A key intermediate in fatty acid synthesis ——-Malonyl CoA—-inhibits —-carnitine acyltransferase I, thereby blocking the entry of fatty acyl units into the mitochondrion for oxidation.

The substrates for fatty acid oxidation, ——Fatty acyl CoAs ——-, inhibit fatty acid synthesis by interfering with the polymerization of acetyl-CoA ——carboxylase ——.

Hormonal effects on adipocytes are opposed:——- Insulin ——-promotes fatty acid ———-synthesis ——-by several mechanisms;——Glucagon ——promotes fat breakdown and fatty acid ——Oxidation ——

8 0
3 years ago
A comparison of ATP and glucose
erica [24]

Answer:

Glucose and ATP are organic compounds composed of carbon, hydrogen and oxygen. Cellular respiration breaks down glucose into water and carbon dioxide producing 38 net ATP molecules. ATP is the energy containing nucleotide in cells while the energy found in glucose is used to make ATP

6 0
3 years ago
Other questions:
  • Where is the esophagus situated in relation to the trachea?
    14·1 answer
  • What is fusion and how does it relate to e=mc squared?
    12·1 answer
  • What best explains the trend shown?
    11·2 answers
  • Which system protects us from radiation and the vacuum of space?a. geosphereb. hydrospherec. atmosphered. biosphere
    6·1 answer
  • Select all the correct answers.
    9·2 answers
  • Explain how an environment would rebound after a volcanic eruption (include the type of succession and pioneer species)
    8·1 answer
  • Mutated codons code for what in silent mutations?
    13·1 answer
  • Nêu 2 cách hoạt động của glutathion trong tế bào hồng cầu
    14·1 answer
  • Define population density as a<br> mathematical equation.
    5·1 answer
  • glucose levels go up in the bloodstream after a meal. beta cells of the pancreas detect the elevated glucose levels. this causes
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!