1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
Define atomic number, atomic weight and atomic mass.
lozanna [386]
Atomic number shows the number of protons in the nucleus of an atom.
Atomic weight shows the is an another term for atomic mass, which means <span>It is approximately equivalent to the number of protons and neutrons in the atom (the mass number) or to the average number allowing for the relative abundances of different isotopes.</span>
6 0
3 years ago
If macro molecules are known as polymers why is each subunit known as a monomer?
s344n2d4d5 [400]
In the text it says “Most macromolecules are made from single subunits, or building blocks, called monomers. The monomers combine with each other using covalent bonds to form larger molecules known as polymers. In doing so, monomers release water molecules as byproducts. ... In the process, a water molecule is formed.” I hope this helped
6 0
2 years ago
5. Cranberries have a pH between 2.3 and 2.5. This makes them an
ExtremeBDS [4]

Answer:

Cranberry Juice pH

Explanation:

Foods that have a pH above 7.0 are considered alkaline, while those with a pH below 7.0 are acidic. Cranberry juice typically features a pH of between 2.3 and 2.5, making it a fairly acidic beverage.

8 0
2 years ago
The second stage of cellular respiration is _____.
erica [24]
The Krebs cycle. The steps are 1. Glycolysis 2. Krebs Cycle 3. Electron transport chain. The Calvin cycle is in photosynthesis.
3 0
3 years ago
Read 2 more answers
As the distance from a magnet increases, what happens to the magnetic force?
Ganezh [65]
The magnetic force decreases.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is in the correct order of the three periods in prenatal development from conception to birth? Group of a
    9·1 answer
  • If a farmer does not plant a crop in one field, and then plows the field in the fall, how could this help restore nitrogen and p
    12·1 answer
  • Liposomes consist of ________ bilayers that enclose an aqueous compartment where drugs can be contained for delivery to specific
    10·1 answer
  • Strongest causes of climate change .
    13·1 answer
  • A community of plants and animals together with its environment is a(n) ______.
    11·2 answers
  • I don't know what I am supposed to do or how to do it?
    6·1 answer
  • 2. What are the forces of nature that affect your life on a daily/monthly/seasonal<br> basis?
    13·1 answer
  • what is the body’s requirement to maintain a constant internal environment (homeostasis) by both internal and external factors.​
    12·1 answer
  • What REASONING connects the evidence to the claim
    13·1 answer
  • Reptiles are better suited to dry land than their amphibian ancestors because
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!