1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
Hemophilia is an X-linked recessive disease. If a mother without the disease and a father without the disease have one son diagn
OLga [1]
The answer to this question is A- 0%
8 0
3 years ago
List three resources used in agriculture
Simora [160]

Agriculture depends on the conservation of our most precious natural resources: <em>water, land, and biodiversity.</em>

7 0
3 years ago
Read 2 more answers
A 55-year-old male was admitted to the hospital with heart failure. he complains of increasing shortness of breath on exertion,
Kipish [7]
This patient both has left-sided heart failure and right-sided heart failure. In left-sided heart failure, this patient exhibits increasing shortness of breath on exertion as well as three pillow orthopnea which indicates pulmonary congestion. This is because of pooling of blood in the pulmonary circulation. Bipedal edema, in this patient is a grade 2 bipedal edema, reflect right-sided heart failure as there is pooling of blood in the systemic circulation, causing transudation in the most dependent areas of the body. 
7 0
3 years ago
The allele for brown hair (b) is dominant to the allele for blonde hair (b). if a man with brown hair and a woman with blonde ha
Alexxx [7]
Are any of the answers capitalized? I believe it's Bb.
3 0
3 years ago
A plant uses a gas from the air to make sugar during photosynthesis. This process is part of the..
Anit [1.1K]

Answer:

Plants are autotrophs, which means they produce their own food. They use the process of photosynthesis to transform water, sunlight, and carbon dioxide into oxygen, and simple sugars that the plant uses as fuel.

Explanation:

3 0
3 years ago
Other questions:
  • Identify the stages where gravity causes water to move downward.
    7·2 answers
  • The skeletal part of the musculoskeletal system: helps the body to create heat. protects the organs of the body. produces facial
    14·1 answer
  • Which of the following will have the highest average temperatures?
    6·2 answers
  • Why do most vaccinations have names like Hong Kong, Shanghai, etc..?
    6·1 answer
  • The type of cell division that produces body cells?<br> mitosis or meiosis
    12·2 answers
  • What is the importance if the carbon and nitrogen cycles to ecosystems
    5·1 answer
  • Throughout the lifespan, we change physically, cognitively, and psychosocially. This illustrates the notion that development is
    9·1 answer
  • What male reproductive gland is missing in the cat
    14·1 answer
  • What feature of alcohol fermentation makes it more suitable for the baking process than lactic acid fermentation?
    11·2 answers
  • In his theory of evolution, Charles Darwin was not able to explain
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!