1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
What operation is used when simplifying fractions and conversion units?
astra-53 [7]

Answer:

  cancellation

Explanation:

A factor in the numerator is <em>cancelled by dividing it</em> by the same factor in the denominator. The quotient is 1, the multiplicative identity element.

4 0
4 years ago
Which is the best reason for using a temperature probe instead of a thermometer?
Svetllana [295]
The best reason to use a temperature probe is to<span> record continuous measurements over several minutes.</span>
5 0
3 years ago
What are most of a baby skeleton composed of?
algol [13]

Answer:

bones

Explanation:

bones

6 0
3 years ago
Glucose provides energy for cells. Different cells have different mechanisms for glucose intake. Intestinal cells contain protei
viva [34]

Answer:

food energy to the body 72-hour make your body healthy enough for different type of exercises in a day

5 0
3 years ago
After suffering a brain injury by falling from a ladder, Zack's wife continues to tell the doctor that his personality has chang
Ivenika [448]

Answer:

frontal lobe

Explanation:

  • The cerebral cortex of the brain has four paired lobes.
  • one of these four paired lobes is the frontal lobe and it occupies 2/3rds of the entire human brain.
  • the frontal lobe is associated with performing tasks such as speech and language production, walking and running, classifying and identifying objects, reacting to feelings, forming memories, forming the personality of a person, and attention involving tasks.
  • Since after the injury, Zack has an altered personality and his reaction to the situation has changed, this points out to the fact that he is most likely suffering from frontal lobe injury.
5 0
3 years ago
Other questions:
  • The sucking response observed in newborn human infants is an example of a(n):
    8·1 answer
  • The ability of scientists to provide models of the
    9·1 answer
  • What functions do endocytosis and exocytosis carry out for the cell?
    10·2 answers
  • Think back to what you've eaten over the past 24 hours. would you say your diet is composed of mainly carbohydrates , proteins,
    9·1 answer
  • In many kinds of organisms, in heritable differences are due mostly to
    6·1 answer
  • What happens to the protein of the cell membrane that surrounds a large molecule during endocytosis?
    15·1 answer
  • What is the control group
    5·1 answer
  • In Stage 1 of his lab, Gunther adds 20 mg of solute into a solution. He stirs it and it completely dissolves. In Stage 2, he add
    12·2 answers
  • TRUE OR FALSE
    10·1 answer
  • Humans affect Earth in many ways. The use of fossil fuels, the clear-cutting of forests, and controlled burns can affect the car
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!