1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
Hot coffee in a mug cools over time and the mug warms up . which describes the energy in the system
Naddik [55]
<span>Thermal energy from the coffee is transferred to the mug.</span>
8 0
4 years ago
Legumes, a type of plant, require Rhizobia, a type of soil bacteria, to survive since these organisms fix nitrogen during photos
Archy [21]

Answer:

rhizobia is an important nitrogen fixing bacteria found in the soil to help grwo plants like legumes. rhizobia enter into a symbiotic relationship withe legumes

Explanation:

rhizobia and legumes coexist by entering into a symbiotic association.  rhizobia is a bacteria that fixes nitrogen molecules for the legumes and in return the legumes provide the bacteria with food and nutrition.

If rhizobia becomes extinct in the near future it would be difficult for plants like legumes to grow as they wouldn't get sufficient nitrogen and nitrogen is an important nutrition for the plant to grow and develop. Thus it can cause rapid depletion or death of plants that need rhizobia to fix nitrogen molecules for them.

5 0
3 years ago
Read 2 more answers
ABOUT ALBERT EINSTEIN <br><br>FRIEND TELL ME ABO<br>UT​
STatiana [176]

her you go : mark as brainliest please

Explanation:

Albert Einstein was a German mathematician and physicist who developed the special and general theories of relativity. In 1921, he won the Nobel Prize for physics for his explanation of the photoelectric effect. In the following decade, he immigrated to the U.S. after being targeted by the German Nazi Party.Sep 1, 2020

Birth Date: March 14, 1879

death :april 18 1995

mark as brainliest

6 0
3 years ago
Read 2 more answers
Que es la evolución ?
Jet001 [13]

Explanation:

Evolution involves changing the hereditary characteristics of a population through generations. These traits are the expression of genes that are passed on to offspring during reproduction.

7 0
4 years ago
Which type of microscope has the lowest magnification power
fomenos
A dissection microscope<span> is light illuminated. The image that appears is three </span>dimensional<span>. It is used for dissection to get a better look at the larger specimen. You cannot see individual cells because it has a low magnification. Or just call it a dissecting microscope</span>
6 0
4 years ago
Read 2 more answers
Other questions:
  • Why do fish need the suns energy
    13·1 answer
  • Most animal cell membranes have proteins that pump ______ ions out of the cell and potassium ions into the cell.
    11·1 answer
  • Almonds may be small, but they pack a great number of nutrients, including protein, vitamin E, and vitamin B2. Almonds also cont
    14·2 answers
  • What will result in a decrease of gfr?
    10·1 answer
  • What two components are often found as part of an enzyme?
    10·2 answers
  • The questions is one the picture above. <br><br> PLEASE HELP!!
    9·1 answer
  • Some isotopes of elements are unstable and decay into other, more stable isotopes over time. For example, it takes 153 years for
    7·1 answer
  • Segments of DNA that contain the code for specific proteins are called.
    13·1 answer
  • What is the name for a large region with consistent organisms and weather?
    6·2 answers
  • Do you know the different stages through which raw agricultural materials go before they reach your table? Trace the journey of
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!