1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
8

1. Replicate the following DNA segment 5’

Biology
1 answer:
Wittaler [7]3 years ago
4 0

The answer is

<span> <span>tcgccctactcgcgtacaccgcgtattgac3’ 3’  
</span></span>

<span><span>agcgggatgagcgcatgtggcgcataactg5’</span></span>

 

<span>This is keeping in mind that purines (adenine and guanine) match with pyrimidines (cytosine and thymine).  Adenine specifically pairs with Thyamine while Cytosine pairs with Guanine. Replication means the DNA is being duplicated therefore, the main enzyme is DNA polymerase. Were it transcription (involving transcription to RNA), adenines would match with Uracil </span>


You might be interested in
Which of the following is common to both eukaryotic and prokaryotic cells?
Helga [31]
<span>Prokaryotes don't have a nucleolus as they do not have a nucleus, and neither do they have a Golgi apparatus. A nucleoid is loose DNA which is found in prokaryotes but not in eukaryotes...</span>
8 0
3 years ago
Read 2 more answers
WILL GIVE BRAINLIEST... ONLY HAVE 5 MINUTES TO ANSWER
MrRa [10]
Light waves or gravitational waves sorry if not correct
4 0
3 years ago
Read 2 more answers
Which of the following is necessary for the light-independent reactions to proceed?
Yanka [14]

Answer;

C) ATP

Explanation;

-Photosynthesis can be divided into two parts: the light-dependent reactions and the light-independent reactions (also referred to as the "dark" reactions).

-The two products of the light-dependent reactions of photosystem are ATP and NADPH.  The movement of high energy electrons releases the free energy that is needed to produce these molecules.  The ATP and NADPH are used in the light-independent reactions to make sugar.

-The light-independent reactions, or dark reactions, of photosynthesis are chemical reactions that convert carbon dioxide and other compounds into glucose. These reactions occur in the stroma, the fluid-filled area of a chloroplast outside the thylakoid membranes.

8 0
3 years ago
What's one way that the shape of the insulin receptor is related to its role in cell communication ?
weqwewe [10]

The insulin receptors have specific shape that is compatible to the glucose molecules. The glucose molecules bind to these receptors, which tells the pancreas to release insulin in order to lower the blood glucose level. Any kind of change in the shape of these receptors because of mutation will hinder this cell communication and stop the insulin release. This will lead to high levels of blood sugar level.

6 0
3 years ago
Read 2 more answers
Please help me with this 2nd time asking​
Luden [163]

Answer:

B I think

Explanation:

there are 2 directions and in each direction there are 2 working in it

6 0
2 years ago
Other questions:
  • Part 1 Imagine two cells. One is 10 microns long on each side and the other is 5 microns long on each side. Let’s say the job of
    11·1 answer
  • If black and white true-breeding mice are mated and the result is all gray offspring, what inheritance pattern would this be ind
    15·1 answer
  • Which of the following best describes the relationship between the nucleus and the cytoplasm?
    15·1 answer
  • Ventricular systole begins during the __________ phase of the cardiac cycle. Ventricular systole begins during the __________ ph
    6·1 answer
  • The heritable variation among members of a population comes about because of A)mutation B)adaptation C)competition D)the environ
    10·2 answers
  • Which part of a neuron acts like an antenna to receive messages from other neurons and transmits these messages toward the cell
    12·1 answer
  • These are cells which have become modified and specialized within an organism. Example: The gradual formation of organs in the b
    5·1 answer
  • 7. Some cancers are caused by mutations that stop certain proteins from working. The inactivation of what kind of protein could
    10·1 answer
  • Based on the survey data, what can be concluded about the market for coffee shops in the area
    8·1 answer
  • What does this joke mean? ​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!