Answer:
The key distinction is that in genetic drift allele frequencies change by chance, whereas in natural selection allele frequencies change by differential reproductive success
Explanation:
Hope this helps
PLEASE MARK AS BRAINLIEST !!!
Answer:
<u>positive, negative, or no effect</u>
Explanation:
The kind of effect that a chromosomal change can have on an organism is either positive, negative, or no effect.
The 3 main chromosomal disorders seen in humans are :
- <u>Down's Syndrome</u>
- <u>Klinefelter's Syndrome</u>
- <u>Turner's Syndrome</u>
The nucleus? budding is when two cells reproduce asexually
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
