What are four causes of weathering
2 answers:
Water, Air (wind), Heat, Ice, Cold, Fire etc...
the main 4 causes of weathering is water, wind, ice, heat
<em><u>I hope I help</u></em>
<em><u /></em>
You might be interested in
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
A pairs with T
G pairs with C
vise versa
<span>A. Science creates new technology without creating any problems. </span>
Fungi: Chitin
Algae( water like protists) : Cellulose
Hmm i do not know but you can get dna from the cell.
a. large-mass stars
This is because they take longer to burn out.
