1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elis [28]
3 years ago
12

While studying the function of a G protein-coupled receptor you develop a modified GTP molecule that has the same binding capabi

lities as GTP but cannot be hydrolyzed to GDP + Pi. What effect would this molecule have if added to your GPCR signaling pathway?
Biology
1 answer:
laila [671]3 years ago
7 0

<u>Answer:</u>

Effects Include:

Activates secondary messengers such as cAMP which further activates number of hormones like

  • ADH: production of this hormone causes kidneys to retain more water inside body.
  • GHRH: release growth factors and stimulates growth of organism.
  • ACTH: produces fight or flight responses i.e rise in heart beat, rise in Blood pressure etc
  • TSH: Stimulate the synthesis of Thyroid hormone and enhances the metabolism of body. In rare cases causes Goiter without the deficiency of Iodine.
  • LH: Stimulate follicle maturation and formation of ovules in women.
  • Calcitonin: Decreases blood calcium level by deposition calcium in bones. This effect weakens the muscles.
  • Glucagon: Stimulates glycogen breakdown from liver and muscles and many more effects.

<u>Explanation:</u>

Background Knowledge:

GPCR (G Protien coupled receptors) are present inside plasma membrane in huge amount. As name suggest that these receptors are coupled with G proteins during their inactive state present inside of the cell. During their Inactive state these G proteins are bounded with GDP molecule.

Upon receiving signal molecules from outside of cell alters the shape of GPCR. These receptors also triggers change in G Protein, as a result of this GTP get attached with them. This protein further activates reaction cascades inside of the cell.

What happen if GTP cannot be hydrolyzed to GDP + Pi?

If GTP cannot hydrolyzed in to GDP + Pi than, it cannot be able to dissociate from G proteins. Cascade system doesn't stop and produces many effects on body.

Effects Include:

Activates secondary messengers such as cAMP which further activates number of hormones like

  • ADH: production of this hormone causes kidneys to retain more water inside body.
  • GHRH: release growth factors and stimulates growth of organism.
  • ACTH: produces fight or flight responses i.e rise in heart beat, rise in Blood pressure etc
  • TSH: Stimulate the synthesis of Thyroid hormone and enhances the metabolism of body. In rare cases causes Goiter without the deficiency of Iodine.
  • LH: Stimulate follicle maturation and formation of ovules in women.
  • Calcitonin: Decreases blood calcium level by deposition calcium in bones. This effect weakens the muscles.
  • Glucagon: Stimulates glycogen breakdown from liver and muscles and many more effects.
You might be interested in
32. If available, the body will always digest which macromolecule for energy first?
Tatiana [17]

Answer:

Sty I have not learned this yet hopefully i will next year

7 0
3 years ago
Read 2 more answers
Give an overview of the process depicted in the diagram
Korolek [52]

This is an overview of translation process.

Translation is the process in protein synthesis in which the genetic information encoded in mRNA is translated into sequence of amino acid in polypeptide chain.

Ribosomes bind to mRNA in the cytoplasm and move along the molecule in a 5 prime to 3 prime directon until it reaches a start codon i.e AUG.  Anticodons on tRNA molecules align opposite appropriate codons according to complementary base pairing (e.g. AUG = UAC).  Each tRNA molecule carries a specific amino acid (according to the genetic code) . Ribosomes catalyse the formation of peptide bonds between adjacent amino acids (via condensation reactions) . The ribosome moves along the mRNA molecule synthesising a polypeptide chain until it reaches a stop codon . At this point translation ceases and the polypeptide chain is released



3 0
3 years ago
What is one way in which energy flow differs from chemical cycling?
bija089 [108]
Energy flow is the amount of energy that moves through a food chain 
chemical cycling is the flow of elements and compounds between living organisms and the physical environment 
7 0
4 years ago
Which of the following information could be included in the description of a grasshopper’s niche, but not in a description of it
bixtya [17]

Answer:

The plant species it eats.

7 0
3 years ago
Who is credited with coming up with the<br> name cell ?
SpyIntel [72]

Answer:

Robert Hooke

Explanation:

Have a nice day

8 0
3 years ago
Other questions:
  • Genetics: X Linked Genes
    7·1 answer
  • There are multiple types of mimicry, where animals imitate other animals in order to gain protection from predators or fool prey
    12·1 answer
  • James is making models of plant and animal cells using objects supplied by his teacher to represent organelles. For one cell, he
    6·2 answers
  • Give three examples of reproductive barriers AND Explain how these barriers could lead to
    6·1 answer
  • What caused scientists to change their ideas about cellular structures
    10·1 answer
  • What happens when the body releases perspiration?
    13·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • 5. Which planet is made mostly of gases?<br> A Mars<br> B Venus<br> C Jupiter<br> D Mercury
    15·2 answers
  • What is a solute????
    6·2 answers
  • Where does the energy come from to power passive and active transport?​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!