Answer:
Snapper population is decreasing
Explanation:
The population is decreasing since the human population is increasing dramatically. As the human population increases, the demand for fish and seafood also increases since humans eat seafood and fish. As the demand for fish increases, fishermen fish for these snappers more often and in bigger loads. Snappers cant reproduce faster than these fishermen are hunting for them and so the population decreases
Water, Sunlight energy, and CO2(carbon dioxide)
Answer:
The valence electrons have a role in the bonding of two atoms. The nuclei of each atom are drawn together by their attraction to the valence electrons of the other atom. As the atoms are drawn together by their attractions, electrons from each atom are drawn to the nuclei of both atoms, where they are "shared."
<u>OAmalOHopeO</u>
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
It occurs in organisms because an organism with a beneficial trait/mutation have a higher chnace of surviving compared to organisms that do not. So the organsims that do survive pass on their genes to the next generation, and the bext generation will pass on those genes to the generation after and so on. But all the organisms that do not possess a beneficial trait/mutations will not survive, therefore they cannot reproduce and pass on those genes to their offspring. This means that most of the population will posses that trait/mutation.
Example: Spotted moths camouflage with bark so they are seen by predators and eaten. Black moths are easily seen by predators and are eaten. Spotted moths then pass on their genes to the next generation of moths.
