1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kkurt [141]
3 years ago
15

Please help

Biology
1 answer:
belka [17]3 years ago
6 0
A is the correct answer
You might be interested in
Growth of populations in an ecosystem can be limited by an increase in
Lerok [7]
B or a



Step by step:
7 0
3 years ago
Read 2 more answers
Why doesn't the periosteum cover the articular cartilage of a long bone
Free_Kalibri [48]
The periosteum doesn't cover the portion of bones that contains articular cartilage, which is the cartilage found in joints that keeps the bones from rubbing together. It is not as tightly packed and contains cells that help in bone growth and repair.
4 0
3 years ago
__________ is when an allele of a gene masks a recessive allele.
tatiyna

Dominant is when an allele of a gene masks a recessive allele.

5 0
3 years ago
Read 2 more answers
The cell below is a lung cell of a salamander. In which stage of mitosis is it? What are the structures visible in green and blu
strojnjashka [21]

Answer:

In which stage of mitosis is it? Metaphase

What are the structures visible in green and blue fluorescence? green show Microtubules and blue Chromosome.

Explanation:

The chromosomes align themselves along the equatorial plane of the spindle. They are suspended by microtubules.

4 0
3 years ago
Thyroid hormone increases metabolic rate. <br> a. True <br> b. False. quizlt
ankoles [38]
The answer is true!

Hope that I helped
7 0
3 years ago
Other questions:
  • Use the codon chart to convert this sequence into an amino acid: UCU-CGA-GCC-GUU-GGG-UGA
    12·2 answers
  • How do plants react to their environment?
    14·2 answers
  • Which of the following is the most distal part on a human arm?
    8·2 answers
  • Gina's science teacher tells her that mass and weight are related, but have an important difference due to gravity. Gina's teach
    14·2 answers
  • PLEASE HELP I NEED ANSWERS
    12·1 answer
  • Need an answer ASAP even if its just the begining to understanding what this means
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • As Arctic ice melts faster than expected, more freshwater is put into the oceans. How would this affect thermohaline circulation
    14·2 answers
  • The first step in treating water from a river or lake is usually
    7·2 answers
  • The eurkaryotic cells glycocalyx is..?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!