1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nalin [4]
3 years ago
14

ASAP test Monday

Biology
1 answer:
Varvara68 [4.7K]3 years ago
7 0

"Denatures" is the word you are looking for!

You might be interested in
How do mangroves and coral reefs show mutual relationship?
gogolik [260]

Answer:

The answers below⤵

Explanation:

Mangroves serve as a shoreline protection.

8 0
2 years ago
Read 2 more answers
1. I have a pattern that calls for 2.5 yards of fabric. How many feet do I need? (Answer: 7.5 feet)
CaHeK987 [17]
You have written the answer 7.5feets
4 0
3 years ago
How can a nutrient be a limiting factor in an ecosystem?
r-ruslan [8.4K]
If a nutrient is short in supply, it will limit the organisms growth.
7 0
3 years ago
Which of the following African civilization first adopted christianity ?
s344n2d4d5 [400]

Answer:

aksum

Explanation:

I guarantee this answer is right and also add me on ps4 faded4_twenty

4 0
3 years ago
Hot lava cooling and hardening is an example of
soldier1979 [14.2K]
Stone Merry Christmas have a nice day

5 0
3 years ago
Other questions:
  • What is the significance of Carbon cycle on plants, animals, ocean, and forest.
    6·1 answer
  • Which of the following is the main purpose of mitosis? A. to copy the cell’s DNA B. to divide the cytoplasm C. to help the cell
    10·1 answer
  • Trevor wanted to find out what fertilizer worked best for growing marigolds. He put Miracle Grow on one, Scotts fertilizer on an
    7·2 answers
  • Your science teacher asks you to build a model of a cell. The model should look like a city, and buildings in the city should re
    6·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • According to the map, the area of the continental United States MOST LIKELY A to have volcanic activity is the
    13·1 answer
  • Most of which type of electromagnetic radiation is given off by Earth's surface at night?
    11·1 answer
  • What is the difference between diffusion and facilitated diffusion?
    15·1 answer
  • How are alleles passed for guinea pig fur color and length?
    14·1 answer
  • State three roles of light in photosynthes​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!