1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bonufazy [111]
3 years ago
13

Which one of the following pollutants is responsible for the increase in skin cancer?

Biology
2 answers:
amm18123 years ago
7 0
A. Chlorofluorocarbons would be the right answer hope this helps! 
NNADVOKAT [17]3 years ago
6 0
The answer is Chlorofluorocarbons. Exposure to extremely high levels of chlorofluorocarbons can result in death. Chlorofluorocarbons are organic compounds composed of carbon, fluorine, and chlorine. Chlorofluorocarbons are involved in the destruction of the stratosphere ozone layer resulting in increased exposure to UV radiation which is known to cause skin cancer. 
You might be interested in
What is the correct term for developing
11111nata11111 [884]

Answer:

please give me brainlist and follow

Explanation:

Following fertilization the embryonic stage of development continues until the end of the 10th week (gestational age) (8th week fertilization age). The first two weeks from fertilization is also referred to as the germinal stage or preembryonic stage.

3 0
3 years ago
Read 2 more answers
Ok plz help I been on this test for 2 days
JulsSmile [24]

Answer:

A is evaporation

B condensation

C precipitation

D runoff

E collection

please give me brainlyest

4 0
3 years ago
Dolphins are able to sleep without drowning because they have gills, like fish do. have a special opening that allows air in but
vampirchik [111]

Answer:

They sleep on just one side of their brain at a time

Explanation:

Dolphins are different from fishes that can breathe underwater.

It is necessary for them to get to the surface of the water at intervals to breathe air.

While sleeping, dolphins allows one hemisphere of their brains fall asleep while the other half is fully conscious. This means that If the left brain is sleeping, the right eye stays open and if the right brain is sleeping, the left eye stays open.

This happens so they always know when it's time to surface and breathe and when to escape when there is trouble.

4 0
3 years ago
Read 2 more answers
What is a system? And what is an ecosystem?
Nataliya [291]
Ecosystem: a biological community of interacting organisms and their physical environment.
3 0
3 years ago
Read lines 23 and 24 of the poem.
LuckyWell [14K]

Answer:

is short

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Since viruses are typically 20-200 nm in diameter, the ____ microscope is best for viewing them.
    8·2 answers
  • Sleepwalking is most likely to occur in _____.
    14·1 answer
  • . What is the name for the tail-like appendage that helps cells move? . A.Bacillius. B.Cillia. C.Flagella. D.Spore. . I got C!
    9·2 answers
  • What is special about a prokaryotic cell?
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Answer these questions based on what you learned from the passage. The flagella are like legs . The pili are like DD2 . The cell
    7·2 answers
  • When an object does not move it is because there are unbalanced forces acting on it. please help!
    11·1 answer
  • A student observed cells from an onion root tip in a microscope. The diagram shows her observation. What was happening in the ce
    8·1 answer
  • Compare and contrast geological tilt and fold. (1 point)
    7·1 answer
  • Discuss your thoughts on the overall lab design. Did it help you understand the concepts better, or did it raise more questions?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!