1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksklad [387]
2 years ago
15

During which part of the rock cycle does water break rocks apart

Biology
1 answer:
tekilochka [14]2 years ago
3 0

When it freezes ..................

You might be interested in
Loose DNA that is not coiled is called... <br><br> A. Chromatin<br> B. Chromosome
Vanyuwa [196]
The answer is B chromosome
8 0
3 years ago
Read 2 more answers
What is something people think is true?
nignag [31]
Something people think is true is C.Belief
4 0
2 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Can someone answer this please.
Aleks [24]

D) It can only be used in areas with specific kinds of rivers.

4 0
2 years ago
Categorize the given minerals into metallic and non-metallic minerals?
tangare [24]

Iron, Gold, Aluminum, Sapphires and Copper are the metallic minerals while Quartz, Calcite, Diamond, Rubies, Emerald, Topaz, Coal and Petroleum are the non-metallic minerals.

<h3>What are minerals?</h3>

Mineral is a chemical compound which is normally crystalline in nature. It is a solid substance present in nature made up of one or more and elements which are combined together.

It is formed as a result of geological processes . For example it includes quartz, calcite, sulphur, clay minerals etc. Minerals are used in the production of ceramics oftenly.

Properties of minerals :

1. They have characteristic chemical composition

2. They have highly ordered atomic structures

3. They have several physical properties such as hardness, luster and cleavage.

Thus, Iron, Gold, Aluminum, Sapphires and Copper are the metallic minerals while Quartz, Calcite, Diamond, Rubies, Emerald, Topaz, Coal and Petroleum are the non-metallic minerals.

Learn more about Minerals, here:

brainly.com/question/18078524

#SPJ1

7 0
1 year ago
Other questions:
  • Describe a characteristic of both an Emperor Penguin and Galapagos Penguin that evolved differently due to their different envir
    12·1 answer
  • Why do plants at the bottom of a pond grow better than plants at the bottom of a lake
    13·1 answer
  • Which of the following have astronomers used to measure the angle between two observed celestial bodies?
    13·1 answer
  • Two atoms have two different proton counts. This means that the atoms
    6·1 answer
  • What is the purpose of an experiment in the scientific method?
    5·2 answers
  • Which is most likely to result after a farmer sprays his crops with pesticides
    8·2 answers
  • Where does the energy go after it reaches the top predators?
    7·1 answer
  • All of the above'<br>'<br>'<br>'<br><br>]<br>l]p[][p][
    11·1 answer
  • True or false A molecule is made up of atoms that are joined together.
    12·2 answers
  • What are the chances that the mother and father will have a baby with no freckles? _____ out of 4, or ______ %?​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!