1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VLD [36.1K]
3 years ago
13

One cause of ___ may be deforestation.

Biology
1 answer:
Dmitry [639]3 years ago
7 0
One cause of global warming may be deforestation.
You might be interested in
The process of DNA replication occurs just before
Fantom [35]
It happens right before the cell divides 
7 0
4 years ago
Read 2 more answers
The most forward two teeth on the upper or lower mouth are:
KatRina [158]
The most forward two teeth in the upper or lower mouth are incisors
8 0
3 years ago
Based on the concept of energy transfer, explain why one acre of land can produce more vegetables for human consumption than bee
Ilia_Sergeevich [38]
There are some reasons which could be mentioned:
1)Energy is lost as heat at each feeding level
2)Consumers who feed directly on plants have more energy for themselves than consumers feeding on other consumers. Indeed, energy again is lost in each level.
3)Feeding cattle is not productive, because energy must be transferred from plants to the cattle and then to people.   
8 0
4 years ago
What Division of fungi produce spores in sac-like structures, morels are an example, and many form cup-like structures in additi
Tom [10]

Answer:

Ascomycota.

Explanation:

Fungi are multicellular eukaryotes that includes different organism like yeast and moulds. Fungi can be classified on the basis of their spore formation.

The ascomycota division of fungi produce spores in the sac or bag like structure called ascus. The morels are included in the ascomycota and they also have the ability to form cup-like structure with the sac-like structure.

Thus, the correct answer is option (b).

6 0
3 years ago
Research indicates that ___ releases painkilling chemicals in the brain
Olegator [25]
<span>Running releases painkilling chemicals in the brain called endorphins. Studies indicate that the level of endorphins in the blood increases during aerobic exercise causing a state called "runner's high" and reducing pain. Interestingly enough, drugs like morphine, heroin and opium have some similar characteristics to natural human endorphins, Running produces these chemicals and they bind with opiod receptors in the nervious system to produce pain relief and mild euphoria during exercise. Running has been associated with increase endurance, injury resistance and the capacity to endure pain based on these characteristics.</span>
4 0
4 years ago
Other questions:
  • 30 POINTS! PLEASE ANSWER ASAP!
    7·2 answers
  • Cities closer to water most likely will be<br> A. More dry<br> B. More humid<br> C. Hotter
    10·2 answers
  • Which of the following are pollutants?
    15·2 answers
  • Where is most of the muscle weight found in humans?
    14·1 answer
  • scientific knowledge is generally considered to have a positive effect on Society. and which situation would scientific knowledg
    8·1 answer
  • Intramembranous ossification:
    10·2 answers
  • What is the term for process by which water returns to the earth?
    5·2 answers
  • What organisms are herbivores
    10·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • Which 'if any' of the following are true? Aquatic animals present a greater risk to divers than any other factor. Most aquatic a
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!