1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna007 [38]
2 years ago
11

How is DNA and Protein Synthesis related?

Biology
1 answer:
lana66690 [7]2 years ago
7 0

Explanation:

DNA is divided into functional units called genes. A gene is a segment of DNA that codes for a functional product (mRNA, tRNA, or rRNA). Since the vast majority of genes are transcribed into mRNA and mRNA is subsequently translated into polypeptides or proteins, most genes code for protein synthesis.

You might be interested in
Can someone please help me with this
alex41 [277]

Answer:

The answers is D option why because when he jumps and goes down with a force and opens parachute so lesser force with his acceleration

4 0
2 years ago
Darwin carefully observed the finches of the Galapagos island. What he noticed was that they were similar to the mainland finche
Tresset [83]

Answer: A (colored feathers.)

Explanation: There are many birds with colors that are variously different on the Galapagos.

So, Darwin carefully observed the finches of the Galapagos island. What he noticed was that they were similar to the mainland finches, but each island finch has different colored feathers.

8 0
3 years ago
How do stories differ from scientific explanation?
r-ruslan [8.4K]
Scientific explanation has data or statistics that have been tested and experimented to determine outcomes. Stories are subjective information that has no evidence to back up if it’s true or not.
7 0
3 years ago
White eyes in Drosophila melanogaster result from an X‑linked recessive mutation. Occasionally, white‑eyed mutants give rise to
Setler [38]

Answer: A transposable element is introduced into the regulatory region of the eye color gene and causes gene expression to be reduced, which results in white eyes with red spots

6 0
3 years ago
Read 2 more answers
Which two cellular structures provide protection to the cell? A. nuclear membrane and vacuole B. cellular membrane and cell wall
arsen [322]

Hey there! Cellular membrane and cell wall is your answer.


7 0
3 years ago
Other questions:
  • What is the result if a white individual is crossed with a bluish gray individual?
    14·1 answer
  • Which gas is responsible for global warming and Which gas is responsible for ozone layer depletion?
    11·1 answer
  • All organisms contain dna, and every organisms DNA is made up of 4 nucleotides. the difference between organisms is simply based
    6·1 answer
  • The escherichia coli bacteria that live in your intestine and help break down food are an example of which type of interaction?
    6·2 answers
  • Order smallest to largest.<br><br> organ, cell, tissue, body system
    12·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Kinetic energy depends on
    12·1 answer
  • Question 1: One of the central themes in biology is how DNA, RNA, and proteins are related. Describe how genetic information flo
    13·2 answers
  • Osmotic pressure, or osmosis, pushes water molecules____the area of greater solute concentration.
    7·1 answer
  • healthy soil is able to provide all the nutrients that support plant growth and to do so year after year what biotic or a abioti
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!