1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliina [53]
2 years ago
8

According to the principal of dominance, if a recessive gene for tallness is paired with another recessive gene for tallness, th

e organism _____.
Biology
2 answers:
Alecsey [184]2 years ago
7 0
<span>The organism is guaranteed to be tall, being homozygous for the recessive tallness trait.</span>
AfilCa [17]2 years ago
3 0
According to this principal, if a recessive gene for tallness is paired with another recessive gene for tallness, the organism is categorized as a homozygous recessive in terms of its genotype.
You might be interested in
Part A - Access and view the Louisiana Wetlands Loss: Coastal Erosion animation produced by New Orleans Times Picayune. Describe
Vikki [24]
Hi has been the jdmdmdmd
7 0
3 years ago
Define reproduction plz
WINSTONCH [101]

Answer:

biological process by which new individual organisms are produced

7 0
2 years ago
Read 2 more answers
Chase is a 22-year-old college student. According to recommendations of the Acceptable Macronutrient Distribution Range (AMDR),
Galina-37 [17]

Answer:

The correct answer would be - average 30%.

Explanation:

According to the recommendations of the Acceptable Macronutrient Distribution Range (AMDR), fat should comprise average 20 to 35% or in average of 30% of the total energy intake each day. The 30 percent of total energy of total energy intake is come from the 50 to 80 grams of fat each day. Chase must have 20 to 35% or in average of 30% of total energy intake.

Thus, the correct answer is - average 30%.

5 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
What is the term for the leaf openings responsible for gaseous exchange?
elixir [45]

Answer:

stomata are the openings in a leaf

7 0
2 years ago
Other questions:
  • Pretest
    10·1 answer
  • Which of the following statements about homologous chromosomes is correct?
    10·1 answer
  • During what geological period do the angiosperms become more common?
    15·2 answers
  • Which of the following biomolecules typically contains both nitrogen and phosphorus?
    11·1 answer
  • What is the main role of the carbohydrate glycogen? A. It forms part of the cell membrane. B. It stores glucose in the body of a
    14·1 answer
  • What features do cells have to deal with extreme hypotonic or extreme hypertonic environments?
    9·1 answer
  • You are studying the source of new virus that has recently infected humans. You suspect that the virus was transferred from othe
    11·1 answer
  • Parents that are heterozygous for having freckles (dominant) are crossed.
    8·1 answer
  • Who are autotrophs ?​
    14·2 answers
  • What is your relationship between matter and energy in an ecosystem ?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!