1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marat540 [252]
3 years ago
8

Choose the arctic environment. Add a friend. Choose "food" as the selection factor. What happened? Why?

Biology
1 answer:
andre [41]3 years ago
8 0
You and that friend would eventally start runing out of food, then its competition. You'll have to fight over it survival of the fitest
You might be interested in
What is the function of the Golgi apparatus? It modifies and stores proteins received from the endoplasmic reticulum. It gives t
tatyana61 [14]
The answer is A.
It modifies and stores proteins received from the endoplasmic reticulum. 
Hope that helped! :)

6 0
4 years ago
Read 2 more answers
In what kind of star system does one star sometimes block the light from another?
Romashka [77]
I think the answer is 3 or 2 i
5 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which of the following is unable to make or create its own energy?<br> OB)<br> OC)<br> OD)
sleet_krkn [62]

the answer I think would be OC

5 0
4 years ago
Read 2 more answers
Help me please and thank you
oksano4ka [1.4K]

Answer:

B

Explanation:

They have the largest species diversity, also we use the same program for our school.

4 0
2 years ago
Read 2 more answers
Other questions:
  • 21. List the 4 largest satellites orbiting Saturn from smallest to largest.
    11·1 answer
  • George has several plants in his garden. Once in a while, he adds fertilizer to the soil. The leaves absorb the nutrients in the
    11·1 answer
  • Describe what happens whan a key stone species is removed from an ecosystem
    15·1 answer
  • Which occurs during digestion
    5·2 answers
  • ◘HURRY PLEASE◘<br> ↓↓↓↓↓↓↓↓↓↓↓↓↓↓
    13·2 answers
  • Why were the fossil remains of Mesosaurus important to Alfred Wegener?
    11·1 answer
  • A researcher exposes a bacterial culture to UV radiation and then subjects it to progressively higher temperatures. As the tempe
    12·1 answer
  • In maize, yellow kernel color is dominant to white, and wrinkled kernel shape is dominant to the smooth form. Considering both o
    8·1 answer
  • genetic engineering is widely used in the field of agriculture and medicine. justify the impact of genetic engineering on humans
    15·1 answer
  • Which organism would best be described as a specialist species?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!