1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masteriza [31]
3 years ago
8

Ribosomal RNA is produced in the cytoplasm. true or false

Biology
1 answer:
WINSTONCH [101]3 years ago
3 0
False 
it's made in the nucleus 
You might be interested in
Urinary obstruction in the lower urinary tract triggers changes to the urinary system to compensate for the obstruction. what is
svetoff [14.1K]
The early change that the system makes in an effort to cope with an obstruction is that the stretch receptors in the bladder wall become hypersensitive. Urinary tract obstruction is a blockage that inhibits the flow of urine through the urinary tract, including the kidneys, ureters, bladder, and urethra. The blockage mat be partial or complete. In response to the obstruction the urinary system is capable of undergoing adaptive changes or responses to compensate for the obstruction.
5 0
3 years ago
The law of states that traits are passed from parents to offspring independently of one another
irinina [24]
Law of independent assortment
7 0
3 years ago
Read 2 more answers
Should fracking be used to release natural gas and oil ?
oksian1 [2.3K]

Explanation:

Fracking is the introduction of substances into a formation in order to increase they pore pressure and to increase natural drive of hydrocarbons.

Fracking has several environmental issues associated with it;

  • Fracking leads to air pollution in case of blowout of gas pressure in formations, particles and dusts can become blasted into the environment.
  • Proppants in fluids channeled into formations can lead to ground water contamination.
  • In areas where fracking is done, there might be an exposure to harmful chemicals.
  • Destruction of the natural habitats of animals.
5 0
3 years ago
Why does DNA replication have such accuracy ?
USPshnik [31]
Because human DNA is so very long (with up to 80 million base pairs in a chromosome) it unzips at multiple places along its length so that the replication process is going on simultaneously and more accurately.
5 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • Is a gel-like substance enclosed by the cell membrane that contains the cell's organelles
    15·2 answers
  • The cytoplasm is the watery fluid found within cells. The cytoplasm holds all of the organelles, except _______, in place within
    9·2 answers
  • What is an advantage of sexual reproduction over asexual reproduction in an environment that changes frequently.
    10·1 answer
  • The suns energy which supports life is transmitted to earth in the form of what
    10·1 answer
  • A client is suspected of having acromegaly. what definitive diagnostic testing is the most reliable method of confirming acromeg
    10·2 answers
  • Is penicillium a plant-like protists, animal-like protsists, or a fungus-like protists?
    7·2 answers
  • Can you identify characteristics of type 1 and type 2 diabetes?To learn about diabetes, watch this BioFlix animation: Homeostasi
    10·1 answer
  • Helen's in 1980, over 200 square miles of pristine forest were buried under millions of tons of lava, ash, mud, and avalanche de
    11·2 answers
  • Suppose you coated the leaves of a plant with petroleum jelly. How would the plant's rate of transpiration be affected?
    5·1 answer
  • WILL GIVE BRAINLIEST IF YOU ARE CORRECT!!!
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!