1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Degger [83]
3 years ago
5

Select the neurological problems that affect women more often than men.

Biology
2 answers:
Anvisha [2.4K]3 years ago
7 0
Fibromyalgia is neurological disorder that involves the brain's communication with the body's pain receptors, via the spinal cord. Fibromyalgia affect women more than men.
nordsb [41]3 years ago
5 0

Answer: Imma say the Parkinson's disease.

This disabling neurological disease affects about 50% more men than women.More than two times more men than women are affected by antisocial personality disorder and substance use disorder. Several cancers, including stomach cancer (2:1), oesophageal cancer (3:1), liver cancer (2:1 to 4:1) and oral cancer (2:1 to 3:1), which have mostly lifestyle-based risk factors, are more common in men.

<h3>Hope this helps have a awesome day/night❤️✨</h3>

Explanation:

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which of these molecules is used for powering cellular processes? ATP Nucleic acids None of these choices Carbon Dioxide
sasho [114]
Its not co2 nor nucleic acids, so ATP.
5 0
3 years ago
How is the information within our DNA structured?
Ksivusya [100]

Answer:

D. as an arrangement of four chemical bases

Explanation:

Our DNA is made up of 4 chemical bases (adenine, thymine, guanine, cytosine).

8 0
3 years ago
Read 2 more answers
When 10,000 molecules of ATP are hydrolyzed to ADP and i in a test tube, about half as much heat is liberated as when a cell hyd
Korolek [52]

Answer:

C. Reactant and product concentrations in the test tube are different from those in the cell.

Explanation:

Cells convert some of the energy from ATP hydrolysis in to different forms of energy other than heat. ATP energy does not always generate more heat.  Many times, energy is used for different purposes.

4 0
3 years ago
Read 2 more answers
What is the unknown mineral most likely that has a density of 7.14
Gelneren [198K]
The answer would be iron
5 0
3 years ago
Other questions:
  • A pet store has two guinea pigs. One has white fur and one has black fur. The white guinea pig has two recessive alleles for fur
    7·2 answers
  • What is the full meaning of dna
    11·2 answers
  • Submarine canyons are usually found in which region?
    5·1 answer
  • If cyanobacteria never evolved during earth's history, how would their absence affect the composition of earth's atmosphere?
    12·1 answer
  • Why does a butterfly look like the face of an owl?
    5·2 answers
  • 9. Which of the following is not a part of the peer review process or its result? A. Ensuring that work meets the standards of t
    15·1 answer
  • 4. How do many scientists explain the formation of the earth?
    11·1 answer
  • What is the GDP per capita in Nicaragua?<br> $3,900<br> $5,900<br> $7,900<br> $9,000
    10·2 answers
  • A student observes that a type of eubacteria contains chlorophyll. Which of these does this type of bacteria have in common with
    11·1 answer
  • When looking at each pair, how many chromosomes<br> in each pair come from the mother and father?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!