1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Degger [83]
3 years ago
5

Select the neurological problems that affect women more often than men.

Biology
2 answers:
Anvisha [2.4K]3 years ago
7 0
Fibromyalgia is neurological disorder that involves the brain's communication with the body's pain receptors, via the spinal cord. Fibromyalgia affect women more than men.
nordsb [41]3 years ago
5 0

Answer: Imma say the Parkinson's disease.

This disabling neurological disease affects about 50% more men than women.More than two times more men than women are affected by antisocial personality disorder and substance use disorder. Several cancers, including stomach cancer (2:1), oesophageal cancer (3:1), liver cancer (2:1 to 4:1) and oral cancer (2:1 to 3:1), which have mostly lifestyle-based risk factors, are more common in men.

<h3>Hope this helps have a awesome day/night❤️✨</h3>

Explanation:

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Which polymer
amm1812
It’s actually bacterial DNA
8 0
3 years ago
The heritability of intelligence is highest among select one:
uranmaximum [27]
The correct answer is a: genetically similar individuals who have been raised in similar environments.
<span>For example, monozygotic twins, who share 100% of their DNA that grew up in the same home have the highest correlation of their IQs (correlation is 0.86). </span>
3 0
3 years ago
I hate me self I’m so sad
Dmitry [639]

Answer:

be happy

Explanation:

get enough rest and eat good

8 0
2 years ago
Read 2 more answers
I need help with this this i don’t get this
guajiro [1.7K]

Answer:

D because the others have nothing else deals with an empty garden that has an effect on things

Explanation:

8 0
3 years ago
Other questions:
  • Advances in technology have helped many industries, including agriculture. Which agricultural application is most
    13·1 answer
  • The portion of the brain that controls body temperature, thirst, appetite, and water balance is the
    15·1 answer
  • Which type of organism aids in digestion, but can give us strep throat?
    15·1 answer
  • Why will liquid 2 keep on burning even if the flame is dead
    6·1 answer
  • What biome receives more then 10 inches a year?
    5·1 answer
  • Answer A or B
    15·1 answer
  • Chloe explains to Jordan the importance of photosynthesis in an ecosystem. Which sentences should she use in her explanation?
    15·2 answers
  • Which important event occurs in the second trimester? (1 point)
    7·1 answer
  • Pls give me the answer to the questions below
    12·1 answer
  • Viruses cannot reproduce on their own and require a host organism to do it for them. This is one reason viruses are not consider
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!