1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marysya12 [62]
3 years ago
10

It is (hotter or colder) at the top of the mountain? Why? (explain below)

Biology
1 answer:
mestny [16]3 years ago
6 0
It is colder at the top of a mountain because there is less air pressure. The same amount of heat is now in a larger area so it is more spread out.
You might be interested in
A nerve is actually a long threadlike bundle of ________ that conduct electrical impulses.
Fiesta28 [93]

Answer:

<em>Dendrites</em>

Explanation:

6 0
2 years ago
Identify the structures in the cell
densk [106]

Answer:

The cell structure has specific functions that are essential to carry out life's processes. These components include the cell wall, cell membrane, cytoplasm, nucleus, and cell organelles.

Explanation:

5 0
2 years ago
Which genes would a crop scientist most likely insert into a crop to protect it from droughts and insects?
Aleonysh [2.5K]
Commonly, genes from bacteria are inserted into a crop's chromosomes to produce pesticide substances to kill insects

For drought, I'm not fully sure, but Maize is a very drought resistant crop often introduced to communities which receive little rainfall. Maybe they take a gene from the maize crop and insert it into the chromosomes
8 0
3 years ago
Will give brainiest and 5 stars and tys!! Please answer quick.
True [87]

Answer:

A :)

Explanation:

8 0
2 years ago
Read 2 more answers
Which answer best shows an animals adaptation to the tropical forest?
IRISSAK [1]
bb i need the answers to tell u something
6 0
2 years ago
Other questions:
  • What is the role of DNA in transmitting genetic information? Describe DNA’s important genetic role in a few sentences below.
    13·2 answers
  • Blood is a mixture. Donated blood often is refined in laboratories to separate it into parts. What are those parts? What are the
    15·1 answer
  • How many carbon atoms are in the products of cellular respiration? Hydrogen atoms? Oxygen atoms?
    13·1 answer
  • Meiosis occurs in a series of different phases and creates genetically unique reproductive cells. The steps of meiosis are shown
    5·1 answer
  • Earth's 24-hour rotation rate is one of thing that makes our planet so friendly to life, allowing most parts of Earth to stay a
    6·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What statement is true about fossils
    12·2 answers
  • You are looking to withdraw some blood-forming tissue for a transplant. You would want to take this tissue from​
    8·1 answer
  • Can someone please help me with this? I can’t figure it out.
    14·1 answer
  • 12 Which does not produce carbon dioxide?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!