1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mrac [35]
3 years ago
13

All of the statements about the nitrogen cycle are true EXCEPT one. That is

Biology
2 answers:
lawyer [7]3 years ago
6 0
The correct answer would be C
Gnom [1K]3 years ago
4 0

Answer: Option (C) is the correct answer.

Explanation:

Nitrogen cycle is defined as the continuous process in which nitrogen and its compounds are interconverted in the environment and living organisms.

For example, when lightening breaks nitrogen molecules then it combines with oxygen.

Thus, we can conclude that all the given statements are true except the statement bacteria located in the soil trap excess nitrogen and help to remove it from plant roots.

You might be interested in
What's up these organisms has an exoskeleton?
Ainat [17]
The most common organisms with exoskeletons are arthropods which include insects (bees, ants), arachnids (spiders) and crustaceans (lobsters and crabs).
4 0
3 years ago
Which has higher air pressure—warm air or cold air? How do you know?
Masja [62]
The one with higher air pressure is Warm Air.  The reason why is because when you boil water, the water always makes the lid rise.  This is because Warm Air has more activity in its atoms and molecules, so it is moving around more, which in turn means that there is more pressure.  

Hope I helped.  :)
7 0
3 years ago
(1) What transports oxygen through the body?
devlian [24]

Answer:

(1) Red Blood Cell

(2) Enzymes

Explanation:

(1) Oxygenated Red Blood cells transport oxygen from the lungs through the body using the arteries as a channel of movement to all organs.

(2) Enzymes are proteins that catalyze chemical reaction in the digestion of food so as to break food down into a form which can be absorbed by the body.

4 0
3 years ago
Homeostasis will be MOST affected by the removal of the
motikmotik
Cell Membrane 

Hope this helps =]
6 0
3 years ago
Read 2 more answers
The Cretaceous-Tertiary extinction, the most famous of the Big Five, has been attributed to what major event(s) that triggered t
polet [3.4K]

This question has a two part answer. The first part is that an asteroid hitting the earth and the second part is massive volcanoes erupting around the world.

5 0
3 years ago
Read 2 more answers
Other questions:
  • The fusion of two deuterium nuclei requires extreme temperature and _____.
    5·2 answers
  • What is Homeostasis?
    11·2 answers
  • You have been instructed by the supervisor of your research laboratory to increase the osmotic pressure of a solution. Select al
    6·1 answer
  • 16. The goals of biodiversity conservation include all of the following EXCEPT (1 point) protecting individual species. introduc
    13·2 answers
  • How many organelles are in both plant and animal cells?
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Lets see if you can Answer this test!
    9·2 answers
  • If a male with hemophilia and an unaffected (non-carrier) female had a child, what is the probability that the child will be an
    8·1 answer
  • What is the relationship between the nucleotides, nucleic aids, and DNA?
    9·1 answer
  • 1. What effect does the music have on the murals as Sierra and Robbie danced?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!