1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DENIUS [597]
3 years ago
10

A person who has a disorder caused by a recessive allele is

Biology
1 answer:
Paul [167]3 years ago
8 0

B. homozygous for the recessive allele.

The only way you have a disease caused by a recessive allele is that both of your copies are recessive.

You might be interested in
Peter suffers damage to his left frontal lobe and loses the ability to speak, although he can still understand speech. Despite t
ELEN [110]

Answer:

This phenomenon is known by neuroscientists as Neuroplasticity, or brain plasticity

Explanation:

Think of plasticity, Neuroplasticity, or brain plasticity, is the simplest terms, as the ability of parts of the brain to adapt their function or ability to change throughout life.

Structural plasticity - brains ability to change in response to the environment.

Functional plasticity-brains ability to change in response to the activities.

6 0
3 years ago
En el hombre el color negro de los ojos “A” domina sobre el color azul “a” Una pareja en la que el hombre tiene los ojos negros
umka21 [38]

Las respuestas a estas preguntas son:

a) Genotipo del padre Aa (ojos negros)

b) Cruzamiento: Aa (padre) x aa (madre)

c) Frecuencias genotípicas esperadas: 1/2 Aa; 1/2 aa  

En genética, dominancia completa se refiere al proceso  de herencia en la cual un individuo heterocigota, es decir, el individuo que presenta dos alelos diferentes para el mismo gen, presenta el mismo fenotipo que un individuo homo-cigota para el alelo dominante (el alelo dominante es aquel que enmascara la expresión del alelo recesivo en individuos heterocigotas).

En este caso, el carácter 'color de ojos' presenta un patrón de herencia monogénica, donde el alelo 'A' dominante codifica para el rasgo fenotípico ojos negros, mientras que el alelo 'a' recesivo codifica para el rasgo fenotípico ojos azules.  

En el ejemplo, la pareja tuvo progenie en la cual uno de los hijos presenta el rasgo recesivo ojos claros, con lo cual el padre debe ser heterocigota y poseer un alelo recesivo 'a'; mientras que la madre expresa el fenotipo recesivo y por lo tanto su genotipo es 'aa'. En consecuencia, el cruzamiento de un padre heterozigota 'Aa' con una madre homo-cigota recesivo 'aa' producirá una descendencia con una frecuencia genotípica esperada de 1/2 (50%) de hijos con ojos 'color negro' de genotipo Aa y 1/2 (50%) de hijos con ojos 'color celelste' de genotipo aa >>

Cruzamiento: Aa (padre) x aa (madre)

Gametos padre: 1/2 A; 1/2 a

Gametos madre: 100% a

Cuadro de Punett (combinaciones gaméticas):

                  A           a

a               Aa          aa

a               Aa          aa

En consecuencia,  este cruzamiento producirá 50% individuos ojos color negro (genotipo Aa) y 50% individuos con ojos color celelste (genotipo aa)

Podés encontrar más información sobre este tema en:

brainly.com/question/22398195?referrer=searchResults

7 0
2 years ago
In the si system time can be meaasured in _____.
belka [17]
The si unit for time is the second
7 0
3 years ago
Sort the following words or phrases as descriptions or examples of fibrous proteins, globular proteins, or both. Exhibit primary
Debora [2.8K]

<u>Answer:</u>

<em>Polymers of amino acids can be both fibrous as well as globular protein. Hemoglobin is a globular but the collagen is the fibrous protein both being the amino acids.</em>

<u>Explanation:</u>

  • <em>Soluble in water: </em>globular protein is soluble in water.
  • <em>intermediate filaments:</em> fibrous protein
  • <em>Insoluble in water:</em> fibrous protein is insoluble in water.
  • <em>function as structural proteins in the cell:</em> fibrous protein.
  • <em>some function as enzymes: </em>globular protein.
  • <em>structure is somewhat spherical;</em> globular protein.
  • <em>structure is rod-like:</em> fibrous protein
7 0
3 years ago
Which portions of the large intestine are located in the pelvic cavity?
Whitepunk [10]

The sigmoid colon, which begins in front of the pelvic brim, is a section of the large intestine that is located in the pelvic cavity.

The sigmoid colon typically measures 25 to 40 cm in length (10 to 15.75 in). As a continuation of the descending colon, the sigmoid colon is a "S"-shaped section of the large intestine that starts in front of the pelvic brim and changes into the rectum at the level of the third sacral vertebrae.

<h3>The large intestine is it located in the pelvic cavity?</h3>

The urine bladder, the remainder of the large intestine (the bottom region), and the internal reproductive organs are all located in the pelvic cavity, which is the lower part.

<h3>Which digestive system organ is located in the pelvis?</h3>

The inferior portions of various abdominal viscera are located in the larger pelvis (terminal ileum, cecum, sigmoid colon).

<h3>Where in the abdominal cavity is the big intestine?</h3>

From the ileocecal junction to the anus, the large intestine continues the ileum for 1 to 1.5 meters. The majority of the large intestine is found in the abdominal cavity, and the remaining part is found in the pelvic cavity.

learn more about large intestine here

<u>brainly.com/question/3476947</u>

#SPJ4

3 0
2 years ago
Other questions:
  • Which of these is the BEST way to illustrate the percentage of students receiving A's, B's, C's, D's and F's on a recent test?
    15·1 answer
  • Question 8 (5 points)
    14·2 answers
  • The perimeter is<br>2/3 +3/4 +2/3 +3/4
    12·1 answer
  • In 1990, Carl Woese introduced the three
    12·2 answers
  • Please heeeeeelp
    7·1 answer
  • PLEASE HELP I feel like the answer is number 4 but im not sure.
    15·1 answer
  • Drugs that block the operation of a neurotransmitter are called _______
    14·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • How does non-human life in an urban ecosystem differ from non-human life in an undeveloped forest ecosystem? (Site 1)
    7·1 answer
  • Fossils of the same type and same age have been found on different continents. If we were to put South America and Africa togeth
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!