1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artyom0805 [142]
3 years ago
12

Match each product of pyruvate metabolism with the condition under which it is produced.

Biology
2 answers:
timofeeve [1]3 years ago
7 0

Answer: The products of pyruvate metabolism are lactate, ethanol and acetyl CoA

Explanation:

Lactate: Lactate is produced by anaerobic fermentation that takes place in the skeletal muscles in humans.

Ethanol: Ethanol is produced through fermentation process yeast and bacteria.

Acetyl CoA: Aerobic Oxidation of pyruvate give rise to acetyl CoA is which the starting molecule in the citric acid cycle.

slega [8]3 years ago
4 0

Answer:

Pyruvate under aerobic condition is converted to acetyl CoA by pyruvate dehydrogenase which enters the TCA cycle for complete oxidation or used for fatty acids synthesis.

Under anaerobic condition pyruvate can be converted to lactate by lactate dehydrogenase, It can also be converted into the amino acid alanine by the enzyme alanine transaminase .

Pyruvate may be channeled back to glucose through gluconeogenesis by converting pyruvate to oxaloacetate which is also a precursor for malete and aspartate shuttle.

You might be interested in
What's is in the earth planet
Soloha48 [4]
Oxygen, liquid water, and life is on planet earth
6 0
4 years ago
4
Inessa [10]

Answer:

D) Wildlife Conservation

4 0
4 years ago
Read 2 more answers
A biologist examines a series of cells and counts 160 cells in interphase, 20 cells in prophase, 6 cells in prometaphase, 2 cell
Marrrta [24]

Answer:

M phase: 4.8 hr

Prophase: 2.4 hr

Prometaphase: 0.72 hr

Metaphase: 0.24 hr

Anaphase: 0.84 hr

Telophase: 0.6 hr

Explanation:

Mitosis, also known as M phase, is the process of nuclear division after interphase, which is followed by cytoplasmic division via cytokinesis. Mitosis can be subdivided into the following phases: Prophase,  Prometaphase, Metaphase, Anaphase, and Telophase. In this case, 160 cells are in interphase (for a total of 200 cells), thereby 40 cells are in mitosis >> 200 - 160 = 40 cells. Since the complete cell cycle requires 24 hours, it is possible to calculate the average duration of each phase:

M phase: 40/200 = 0.2 x 24 hr = 4.8 hr

Prophase: 20/200 = 0.1 x 24 hr = 2.4 hr

Prometaphase: 6/200 = 0.030 x 24 hr = 0.72 hr

Metaphase: 2/200 = 0.01 x 24 hr = 0.24 hr

Anaphase: 7/200 = 0.035 x 24 hr = 0.84 hr

Telophase: 5/200 = 0.025 x 24 hr = 0.6 hr

3 0
3 years ago
CUAL ES MEJOR KING KONG O GODZILLA
Art [367]

Answer:

godzilla wins  

Explanat

es jodidamente enorme y considerado un dios. también dijo chupa mi banana

4 0
3 years ago
What can be analyzed to determine how many base pairs a segment of dna has?
irga5000 [103]
The total number of base pairs is equal to the number of nucleotides in one of the strands (each nucleotide consists of a base pair, a deoxyribose sugar, and a phosphate group).
3 0
3 years ago
Other questions:
  • What gas is changed by some bacteria into a form that plants can use?
    13·1 answer
  • The two most common causes of fatal anaphylaxis are
    6·1 answer
  • Why is it that traditionally woman in minorities have been underrepresented in the sciences? How does this change in your genera
    6·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • The synthesis of atp from adp and pi is a(n) _____ reaction with ____ δg. Endergonic; a negative exergonic; a positive endergoni
    7·2 answers
  • Which parts of the plants do they show? (A,B,C,D)<br><br>And 21.question please​
    13·1 answer
  • Which statement best explains why the classification
    13·1 answer
  • What is the atomic number of an element that has 33 protons and 30 neutrons?
    9·1 answer
  • De que estan hechas las rocas<br>​
    10·1 answer
  • g The citric acid cycle is a central metabolic pathway in mammalian organisms. Sources of acetyl-CoA for the pathway include: Th
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!