1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Slav-nsk [51]
3 years ago
9

You have been called for a​ 6-year-old male patient with shortness of breath. On​ scene, you find the patient with a runny nose

and mucus coming from the right nare. Breath sounds are clear and his SpO2 is​ 99% on room air. When​ asked, the patient states that his throat is very sore. His vital signs are​ pulse, 124;​ respirations, 20​ breaths/min; and​ temperature, 98.9°F. There is no medical​ history, according to the mother. Which statement or instruction would be most appropriate for this​ situation?a. "He is very stable, but we will take him to the hospital. The danger lies in the infection spreading to the lungs."b. "Why don't we give him an aspirin for his fever and then you can follow up at your pediatrician's office."c. " I am very concerned he may have epiglottis, so we are going to take him to the hospital with lights and siren."d. "Let's give him some oxygen since the heart rate is most likely elevated because his oxygen is low."
Biology
1 answer:
babymother [125]3 years ago
8 0

Answer:

The correct answer to the question: Which statement or instruction would be the most appropriate for this situation, would be, A: he is very stable, but we will take him to the hospital. The danger lies in the infection spreading to the lungs.

Explanation:

The most important deal here is that this is a child of only six years of age and that he is starting to show an increase in his temperature, as the numbers reach 98.9F, which is on the borderline to actual fever. This indicates that the original infection, which was affecting the upper airways is now starting to affect more. Another point here is the heart rate, which, although not absolutely abnormal for a child of 6, is still showing increases, which indicates the advancement of the infection and the increase of temperature. The mother needs to know that none of the signs show that the child is in inminent danger, that his vital signs in general are stable, but, he does need to be brought for treatment because the signs do indicate that the infection is spreading, and affecting the lungs.

You might be interested in
Select the correct answer.
umka2103 [35]

Answer:

C. It portrays evolutionary change as a smooth curve.

4 0
3 years ago
If you set up an experiment and the results do not support your hypothesis, what should you conclude?
makvit [3.9K]
I think it would be D. because your hypothesis wasn't correct.
5 0
3 years ago
Read 2 more answers
Organisms such as decay bacteria that help recycle dead organic matter are called
Anastasy [175]
Decomposer. Hope it helps!
4 0
3 years ago
ASAP 30 points! What are the 6 planetary patterns (don’t copy and paste from internet!)
Savatey [412]

Answer:

The personal planets are the Sun, Moon, Mercury, Venus and Mars. The social or transpersonal planets are Jupiter and Saturn.

Explanation:

6 0
2 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Other questions:
  • What do food chains measure? -
    7·1 answer
  • What the answer is to this question
    8·1 answer
  • the fossil record indicates that several times in the past, huge numbers of species have disappeared suddenly in phenomenon know
    9·1 answer
  • Which part of the female reproductive system produces ova?
    15·2 answers
  • Ice does not need to melt into liquid water before it can return to the atmosphere as water vapor.
    15·1 answer
  • I GIVE BRAINLY. Justin is walking around an area that has few trees and many tall grasses.
    5·2 answers
  • Plants are best known for their ability to perform photosynthesis, the process by which light energy is converted to chemical en
    13·2 answers
  • With regard to cognitive development, piaget argued that _____ is more revealing than _____.
    15·1 answer
  • Where is the foramen magnum found
    7·1 answer
  • The carbon fixation reaction converts?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!